Entry information : MePrx98 (cassava4.1_027550m)
Entry ID 9151
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx98 (cassava4.1_027550m)
Name (synonym) MePrx98 (cassava4.1_027550m)
Class Class III peroxidase     [Orthogroup: Prx026]*
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx98
start..stop
S start..stop
RcPrx65 323 4e-110 1..281 126..402
MePrx84 304 2e-102 1..281 158..421
CclPrx09 280 2e-92 1..281 162..464
LePrx106 247 3e-80 1..281 166..415
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 192587..192661 75 N° 2 192821..192908 88 N° 3 193470..194149 680  
join(192587..192661,192821..192908,193470..194149)


exon

Literature and cross-references MePrx98 (cassava4.1_027550m)
DNA ref. Phytozome 12:   scaffold04324 (192587..194149)
Protein sequence: MePrx98 (cassava4.1_027550m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   281
PWM (Da):   %s   29867.41  
PI (pH):   %s   4.82
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
VEEVCPGVVSCADIVVLAAREGVVQLPSPLADLSETLASFSSRGFDERETVTLLGAHSIGTIHCKFFESRLYNFGGTNKPDPSMDPQFLNQMRSRCNNSDAPGSPAASPSSDAPEPSSLVPPASFDSPESSSTASSPSYDGSPSPSSEKPGRMGAMSSVAAPSIFPQRSLSFSPSSSRKSTVSYEGSLQSSMEDPGVPMTYEGPGIDFGSVYYHRLLQGRGILYADQQLMSGEETRIWVKAYASDVTLFRRDFAQAMIKLSDLHVLTGSAGQVRFNCSRV

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from phytozome (Gap and extra in frame; 5' is missing due to NNNN in DNA).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTTGAAGAAGTATGCCCTGGTGTTGTTTCTTGTGCTGATATTGTTGTTTTAGCAGCTAGAGAAGGTGTTGTTCAGGTATATATCTCAGTCCTCCCTCCACCTCCTCTCTCTGTCTCTGTC
TCACTTTCAGCGTCTCGTTGAATTTGGGAATTTCAGGCAGGTGGTCCATTCTATCCACTACTAACTGGCAGAAGAGACAGTTTCCGCACTTTCCCAGATATAGCAACTTATGAGCTTCCT
TCACCCCTAGCTGATCTATCTGAAACCCTGGCATCATTTTCATCTAGGGGTTTTGATGAAAGAGAAACAGTCACTCTCTTAG
GTATTATTCTGACGTTCCTTACCTTATTGGTGACATGC
AATCTCTTGATTGAGCTTTGTGCAACTGATCATTATTGTTTGTGATTGTCTCCGCAATGATCTGAGGTTTTATTAATTTAACACCTATTAAATTCCTGTGATTAAAAAAAAACTTCCTTT
TTTCCCCTTCTTTTATCATCATTATCCATAAAAAGGTTTGGTAATGCATTGGGCGTTTAAACTTCTTATTTCTGTTTTTGTTTTTACGATTTGATCCTTAGTTGACAGTGAATTTTTCTT
GCTTTAATAGAAATGGATGCTTATAGATTAATCTATTGTTTGGAAATTGATTCCTCTGACGTGAATTGTGATAGTTAATCTGTTAAAACTGGTTAGAATTTTGTTCTGTAGAAGGGCTAC
ACGTTACTATCTTCTGTTTATGTCCCTGAAGCCACAGACTTTTTGTGCTTGATTAGGCTCATTTCCAAAACATTGTTACCTGTCATGTTCTTGCTTTAGAACTATTCGTTTTGCAGCAAC
CTAGGATCTAAGATTTCTAATTGTTTCTTCGTAACGCTTCTAGGTGCTCATAGCATTGGAACAATCCACTGCAAATTCTTTGAAAGCCGTCTCTACAACTTCGGTGGGACCAATAAGCCA
GATCCCTCTATGGATCCTCAATTTCTTAACCAGATGAGATCAAGATGCAACAATAGCGATGCACCAGGGTCTCCAGCTGCATCACCTTCCTCTGATGCCCCCGAGCCATCTTCATTGGTA
CCACCAGCTTCCTTTGACAGCCCAGAGTCATCATCAACAGCATCATCCCCTTCCTATGATGGATCACCATCTCCATCTTCTGAAAAACCAGGAAGGATGGGTGCAATGTCATCAGTAGCA
GCACCATCAATTTTTCCCCAACGCTCATTGTCCTTCTCACCATCATCATCTAGGAAATCAACAGTTTCATATGAAGGTTCACTGCAGTCCTCAATGGAGGATCCAGGAGTCCCTATGACC
TATGAGGGACCTGGAATAGATTTTGGCTCAGTGTACTACCACAGACTTCTGCAAGGCAGAGGAATCCTCTATGCTGATCAGCAACTAATGTCTGGGGAAGAAACTAGGATCTGGGTTAAA
GCATATGCTTCAGATGTCACCTTGTTCCGCCGAGACTTTGCCCAGGCAATGATAAAGCTCTCAGATCTCCATGTCCTCACAGGTTCAGCAGGTCAGGTCCGGTTCAATTGTTCAAGGGTG
GCA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTTGAAGAAGTATGCCCTGGTGTTGTTTCTTGTGCTGATATTGTTGTTTTAGCAGCTAGAGAAGGTGTTGTTCAGCTTCCTTCACCCCTAGCTGATCTATCTGAAACCCTGGCATCATTT
TCATCTAGGGGTTTTGATGAAAGAGAAACAGTCACTCTCTTAG
GTGCTCATAGCATTGGAACAATCCACTGCAAATTCTTTGAAAGCCGTCTCTACAACTTCGGTGGGACCAATAAGCCA
GATCCCTCTATGGATCCTCAATTTCTTAACCAGATGAGATCAAGATGCAACAATAGCGATGCACCAGGGTCTCCAGCTGCATCACCTTCCTCTGATGCCCCCGAGCCATCTTCATTGGTA
CCACCAGCTTCCTTTGACAGCCCAGAGTCATCATCAACAGCATCATCCCCTTCCTATGATGGATCACCATCTCCATCTTCTGAAAAACCAGGAAGGATGGGTGCAATGTCATCAGTAGCA
GCACCATCAATTTTTCCCCAACGCTCATTGTCCTTCTCACCATCATCATCTAGGAAATCAACAGTTTCATATGAAGGTTCACTGCAGTCCTCAATGGAGGATCCAGGAGTCCCTATGACC
TATGAGGGACCTGGAATAGATTTTGGCTCAGTGTACTACCACAGACTTCTGCAAGGCAGAGGAATCCTCTATGCTGATCAGCAACTAATGTCTGGGGAAGAAACTAGGATCTGGGTTAAA
GCATATGCTTCAGATGTCACCTTGTTCCGCCGAGACTTTGCCCAGGCAATGATAAAGCTCTCAGATCTCCATGTCCTCACAGGTTCAGCAGGTCAGGTCCGGTTCAATTGTTCAAGGGTG
GCA

Retrieve as FASTA