Entry information : MguPrx38 ( mgv1a010025m)
Entry ID 9207
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-28 (Christophe Dunand)
Peroxidase information: MguPrx38 ( mgv1a010025m)
Name (synonym) MguPrx38 ( mgv1a010025m)
Class Class III peroxidase    [Orthogroup: Prx108]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx38
start..stop
S start..stop
MguPrx39 647 0 1..322 1..322
MguPrx84 641 0 1..322 1..322
MguPrx36 637 0 1..322 1..323
MguPrx44 634 0 1..322 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 146826..147035 210 N° 2 147239..147427 189 N° 3 147525..147690 166 N° 4 147884..148284 401
join(146826..147035,147239..147427,147525..147690,147884..148284)


exon

Literature and cross-references MguPrx38 ( mgv1a010025m)
DNA ref. Phytozome 12:   scaffold_52 (146826..148284)
Protein sequence: MguPrx38 ( mgv1a010025m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (300)
PWM (Da):   %s   34575.68 (32182.4) Transmb domain:   %s   i7-25o
PI (pH):   %s   9.26 (9.24) Peptide Signal:   %s   cut: 23 range:23-322
Sequence 363
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSKQVVVFLVLVGLFNLCNAQGLKLGFYKKTCPSVEAIVKKETASIMAVAPTLAAPILRMHFHDCFVRGCEASILLNSTTNNQAEKDSFPNLSLRGYGSIDRVKSAVEKKCPGVVSCADILALVARDAVSFLNGASWPVPLGRRDGNVSNSTEALFNLPPPFFNITQLKASFASKGLNTKDLVVLSGGHTIGTSHCSSFTNRLYNFTGVGDSDPSLDSNYVARLKRRCSATDTTTLVEMDPGSFKTFDIEYYSVVAKRRGLFTSDAALLADSETRAYVTSHATPQGSKDFLKDFAKSMVKMGKIGVLTGSQGEIRKTCGF

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTTCAGTAAGCAAGTTGTTGTATTTCTTGTTTTAGTTGGCCTATTCAACTTATGTAATGCTCAAGGGTTGAAGCTTGGCTTCTACAAGAAGACTTGTCCATCTGTTGAGGCGATCG
TGAAAAAGGAGACCGCTAGTATTATGGCCGTTGCTCCAACTCTTGCAGCTCCTATTCTCAGGATGCATTTTCATGATTGTTTCGTTAGG
GTATGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACATATATATGTATGTGTATAATTTATTTCAAGGCACGATCAAACTTTAATATTTATGTCAACTTTGAAATCCATCAATAT
ATGTTTCTTTAGGTATTTTTATGTTGATGTGCTAATTAGTTACTTTTGATAGGGTTGTGAAGCTTCTATTCTACTGAATTCGACAACAAATAATCAAGCTGAGAAAGATTCGTTCCCCAA
TCTATCCCTTAGAGGATATGGATCCATCGACAGAGTGAAATCTGCAGTTGAGAAGAAGTGCCCCGGTGTTGTTTCTTGTGCTGATATATTAGCTCTTGTTGCACGAGATGCAGTTTCATT
T
GTAAGTACTGAAGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATGTATATATTGTAAATTAGTTGAATGGAGCATCGTGGCCAG
TACCATTGGGAAGAAGAGATGGAAATGTATCAAACAGCACAGAAGCTTTGTTCAATCTTCCACCTCCTTTCTTCAACATCACTCAATTGAAAGCTAGCTTTGCCTCAAAGGGTTTGAATA
CAAAGGATCTTGTTGTTCTCTCCG
GTAATAATTATGTGCTCCCTGTGTTCTAAAATATTTGTCTCTTTTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTTTTAAAATCA
TGTACTACCNNNNNNNNNNNNNNNNNNNNNCATGTACTAAATTATTTTCGTCACTTTCTATATTTTCTTGTAACTAACAAAAACCCTAAATATGCAGGAGGACACACCATAGGAACATCG
CACTGCTCGAGCTTCACTAACCGACTGTACAACTTCACTGGTGTTGGAGACAGTGACCCTTCATTGGACTCAAACTATGTTGCTCGTTTGAAGAGAAGATGCAGTGCGACAGATACCACT
ACACTTGTCGAAATGGATCCTGGGAGTTTTAAGACATTCGACATCGAATACTACAGTGTAGTCGCAAAAAGAAGAGGACTTTTCACATCTGACGCAGCTCTTCTTGCGGACAGTGAAACT
AGGGCTTACGTCACCAGCCACGCTACTCCTCAAGGGTCAAAGGATTTCTTGAAGGACTTTGCAAAGTCAATGGTTAAAATGGGCAAGATTGGGGTTTTGACAGGGAGCCAAGGTGAAATT
AGGAAAACATGTGGTTTC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTTCAGTAAGCAAGTTGTTGTATTTCTTGTTTTAGTTGGCCTATTCAACTTATGTAATGCTCAAGGGTTGAAGCTTGGCTTCTACAAGAAGACTTGTCCATCTGTTGAGGCGATCG
TGAAAAAGGAGACCGCTAGTATTATGGCCGTTGCTCCAACTCTTGCAGCTCCTATTCTCAGGATGCATTTTCATGATTGTTTCGTTAGG
GGTTGTGAAGCTTCTATTCTACTGAATTCGA
CAACAAATAATCAAGCTGAGAAAGATTCGTTCCCCAATCTATCCCTTAGAGGATATGGATCCATCGACAGAGTGAAATCTGCAGTTGAGAAGAAGTGCCCCGGTGTTGTTTCTTGTGCTG
ATATATTAGCTCTTGTTGCACGAGATGCAGTTTCATTT
TTGAATGGAGCATCGTGGCCAGTACCATTGGGAAGAAGAGATGGAAATGTATCAAACAGCACAGAAGCTTTGTTCAATCTTC
CACCTCCTTTCTTCAACATCACTCAATTGAAAGCTAGCTTTGCCTCAAAGGGTTTGAATACAAAGGATCTTGTTGTTCTCTCCG
GAGGACACACCATAGGAACATCGCACTGCTCGAGCT
TCACTAACCGACTGTACAACTTCACTGGTGTTGGAGACAGTGACCCTTCATTGGACTCAAACTATGTTGCTCGTTTGAAGAGAAGATGCAGTGCGACAGATACCACTACACTTGTCGAAA
TGGATCCTGGGAGTTTTAAGACATTCGACATCGAATACTACAGTGTAGTCGCAAAAAGAAGAGGACTTTTCACATCTGACGCAGCTCTTCTTGCGGACAGTGAAACTAGGGCTTACGTCA
CCAGCCACGCTACTCCTCAAGGGTCAAAGGATTTCTTGAAGGACTTTGCAAAGTCAATGGTTAAAATGGGCAAGATTGGGGTTTTGACAGGGAGCCAAGGTGAAATTAGGAAAACATGTG
GTTTC

Retrieve as FASTA