Entry information : MguPrx87 (mgv1a021862m)
Entry ID 9245
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-08 (Qiang Li)
Peroxidase information: MguPrx87 (mgv1a021862m)
Name (synonym) MguPrx87 (mgv1a021862m)
Class Class III peroxidase    [Orthogroup: Prx028]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx87
start..stop
S start..stop
SaPrx41 491 9e-177 25..319 39..334
NtPrx56-1B 469 3e-168 16..319 33..336
StPrx26 468 1e-167 3..319 28..341
NtPrx56-1A 467 2e-167 11..319 14..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 862414..862614 201 N° 2 862768..862947 180 N° 3 863047..863212 166 N° 4 863305..863723 419
join(862414..862614,862768..862947,863047..863212,863305..863723)


exon

Literature and cross-references MguPrx87 (mgv1a021862m)
DNA ref. Phytozome 12:   scaffold_69 (862414..863723)
Protein sequence: MguPrx87 (mgv1a021862m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (302)
PWM (Da):   %s   34844.42 (32735.3)  
PI (pH):   %s   5.38 (5.38) Peptide Signal:   %s   cut: 20 range:20-321
Sequence 362
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQLLCFIILFLATFPPSSSSSLSFDFYTLSCPVVELTVKNTVRSASDVDPTIPGKLLRLLFHDCFVNGCDASVLLQGNATERSDPANQSLGGFSVIDSAKRVLEIFCPGTVSCADILALAARDAVEFTGGPNIQIPTGRKDGRISMAANVRPNIIDTSFTLDEMIKIFSAKGLSIDDLVTLSGAHTIGRSHCGSFNDRFKVDSNGNLTLIDLSLDRQYATQLMKMCPNNNNDRVTVNNDPSSPLQFDNAYFKILLAHKGLFQSDSALLNDERTKNRVVEFANSQDSFFERWSSSFLKLSSVGVKTGGEGEIRQSCSMSNTx

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCAGCTGCTCTGTTTTATCATCCTTTTTCTAGCTACATTTCCTCCTTCTTCTTCTTCTAGTCTCTCTTTCGATTTCTACACACTTTCTTGCCCCGTTGTCGAATTAACGGTGAAAAATA
CAGTCAGATCAGCTTCTGATGTGGACCCCACAATCCCCGGAAAACTCCTCCGTCTGCTCTTCCATGACTGCTTCGTCAAC
GTATAGTTTATTACCAANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCTTCTTACATACATTTAACTATTTTGTTTTAACAGGGCTGTG
ATGCTTCTGTGTTATTACAAGGAAATGCAACCGAAAGAAGTGATCCAGCTAACCAATCACTCGGCGGGTTTTCGGTTATAGATTCAGCAAAGAGAGTTCTTGAAATCTTTTGCCCTGGAA
CAGTTTCTTGTGCTGATATACTAGCATTGGCTGCTCGAGACGCAGTCGAATTT
GTATGTATTTATCGCAAAGATTCGATTTTTATTCAATTATTAGTCTTGAAACATGCATATGTGTATC
GGGGTTTTATTCGTAATTTTTTTCAATTACAGACAGGAGGGCCGAATATTCAGATTCCGACAGGTCGGAAAGACGGTCGGATTTCCATGGCAGCAAACGTGAGACCGAATATTATAGACA
CAAGCTTCACATTGGATGAAATGATCAAGATCTTTTCTGCTAAGGGCTTATCTATAGATGACCTTGTTACCCTCTCCG
GTATACAATCTTTAGCCCCCAACTTTTCGTTTAACAAGGGCA
AAATCGGAAAGAAAAAAAAAGAATTACGTTTTTTTTATTTTTTGTTGCAGGAGCTCACACAATTGGAAGATCGCATTGCGGTTCGTTCAACGATAGGTTTAAGGTCGACTCGAATGGAAA
TCTTACGTTGATCGATTTATCATTGGATAGACAATATGCAACTCAGCTAATGAAAATGTGTCCTAATAATAATAACGATAGAGTGACGGTGAACAACGATCCTTCTTCGCCTCTACAATT
CGATAATGCGTACTTCAAGATTTTGCTGGCTCACAAGGGGCTTTTCCAATCGGATTCTGCGCTGTTAAATGACGAGAGAACGAAGAATCGAGTGGTGGAATTCGCTAATAGTCAAGATAG
TTTCTTTGAGCGATGGAGTTCGTCTTTTTTGAAGCTTTCGAGTGTCGGAGTGAAGACGGGTGGCGAGGGCGAAATTCGACAATCTTGTTCGATGTCTAATACCNNNACA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCAGCTGCTCTGTTTTATCATCCTTTTTCTAGCTACATTTCCTCCTTCTTCTTCTTCTAGTCTCTCTTTCGATTTCTACACACTTTCTTGCCCCGTTGTCGAATTAACGGTGAAAAATA
CAGTCAGATCAGCTTCTGATGTGGACCCCACAATCCCCGGAAAACTCCTCCGTCTGCTCTTCCATGACTGCTTCGTCAAC
GGCTGTGATGCTTCTGTGTTATTACAAGGAAATGCAACCG
AAAGAAGTGATCCAGCTAACCAATCACTCGGCGGGTTTTCGGTTATAGATTCAGCAAAGAGAGTTCTTGAAATCTTTTGCCCTGGAACAGTTTCTTGTGCTGATATACTAGCATTGGCTG
CTCGAGACGCAGTCGAATTT
ACAGGAGGGCCGAATATTCAGATTCCGACAGGTCGGAAAGACGGTCGGATTTCCATGGCAGCAAACGTGAGACCGAATATTATAGACACAAGCTTCACAT
TGGATGAAATGATCAAGATCTTTTCTGCTAAGGGCTTATCTATAGATGACCTTGTTACCCTCTCCG
GAGCTCACACAATTGGAAGATCGCATTGCGGTTCGTTCAACGATAGGTTTAAGG
TCGACTCGAATGGAAATCTTACGTTGATCGATTTATCATTGGATAGACAATATGCAACTCAGCTAATGAAAATGTGTCCTAATAATAATAACGATAGAGTGACGGTGAACAACGATCCTT
CTTCGCCTCTACAATTCGATAATGCGTACTTCAAGATTTTGCTGGCTCACAAGGGGCTTTTCCAATCGGATTCTGCGCTGTTAAATGACGAGAGAACGAAGAATCGAGTGGTGGAATTCG
CTAATAGTCAAGATAGTTTCTTTGAGCGATGGAGTTCGTCTTTTTTGAAGCTTTCGAGTGTCGGAGTGAAGACGGGTGGCGAGGGCGAAATTCGACAATCTTGTTCGATGTCTAATACCN
NNACA

Retrieve as FASTA