Entry information : PpePrx50 (ppa018541m)
Entry ID 9290
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-12-16 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-07 (Qiang Li)
Peroxidase information: PpePrx50 (ppa018541m)
Name (synonym) PpePrx50 (ppa018541m)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx50
start..stop
S start..stop
PpePrx04 663 0 10..344 2..349
RcPrx72 471 3e-168 10..343 26..350
EgrPrx91 473 4e-168 8..344 66..395
EcamPrx91 473 5e-168 8..344 66..395
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 26731600..26731767 168 N° 2 26732463..26732660 198 N° 3 26732988..26733153 166 N° 4 26733285..26733510 226
N° 5 26733562..26733841 280  
join(26731600..26731767,26732463..26732660,26732988..26733153,26733285..26733510 ,26733562..26733841)


exon

Literature and cross-references PpePrx50 (ppa018541m)
DNA ref. Phytozome 12:   scaffold_4 (26731600..26733841)
Protein sequence: PpePrx50 (ppa018541m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   345 (1522)
PWM (Da):   %s   37906.37 (172809.7)  
PI (pH):   %s   6.31 (7.84) Peptide Signal:   %s   cut: 26 range:26-1547
Sequence 386
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEMTDSAATNIEYDFYRDTCPEAETIVRSTMAQIYSQHKNVSAQLLRLFFHDCFIQGCDASVLLDHSNGNKNHSVEKQAVPNKSLKGFDKIDQIKEVLENVCPAVVSCADILALATRDGVVLAGGPFYPLFTGRRDSARSYYDEAMAEIPKPDDNITQTLHLFSLRGFTDRETVSLLGGHNIGKIGCEFIQSRLHNFKGTRKPDPTVSPSFLNEMRVFCEDNGNEKSSQGSPMAANMASPMAFPTTGPMAAPMGMPYFQQLSSSVSSGAGFDTHYYQSLLRGRGLLFADQQLMANERTARLVRAYASDDGSTFRMDFARAMMKMSNLNALTGSQGQVRLECTLAG

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Two extra sequences included in this protein).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAGATGACAGATTCTGCTGCAACGAACATCGAGTATGATTTCTACCGCGATACATGCCCTGAAGCTGAGACCATTGTGAGGTCTACGATGGCTCAGATTTACTCCCAGCACAAGAATG
TCTCTGCTCAGCTTCTGCGCCTCTTTTTCCATGATTGCTTCATTCAG
GTATACCAAGATTCTTCTTTTCTTTATCTTTGAGGTTTTTTTTCTCAAATAGCTTTTGTGCTGATTACTCTGG
GTCCTCTGCTTTTGATCTTGATTGTACTTTTCTGCATCTGTGTGGGTTTCCTGCTTCTAGTCTTGATGGTTCTTTTCTTCATCTATGAATGGCTTTTGTTTGGATTGCTCTGGGGTTTTC
TGCTTTTAATCTTTGTGGTCATTTCCTTCATTCGTGTGGGGTTTTCTCAAATAGGATTTGATTGCTTTAGGTTTTCTGCTTTTAATCTTGGTCGTCCTTTTCTTCGCCTGTGTGGGTTTC
TCAAATGGGTTTTGATTGCTCAGGGTATTGGAATCTGATTCTGATTATTCGGATTCTTACCTTCAATTTGATGTTGTTATTGGGTTCTATGAATCTTGAAACTCTGGGTTGTTCTTTTAT
GGTTGGTTTTTAACACTTGAGAATCTGAAAACTCTTATCTGGGAATGTTAAGCTACAATGCTATAAGATGATTTCGGCATGATATTTTTGAGTTCTTCTGAAATGGGTTTTCGTTTCTTT
GAGTCTTTTGTCTCTAACCTTAGTTTCTGTCTTTTTAATCAAGCATGTATTGGCTCTAACCTTAGTTGGGCTATGATTACCTTACGTGGGTTTCTGTCTAATTCTATCTGTCTTTCTTAA
TGTTGTGGGGTTTTTGAATCAGGGTTGTGATGCTTCTGTCCTCTTGGATCACAGCAATGGGAATAAAAACCATTCCGTAGAGAAGCAGGCTGTGCCAAATAAGAGCTTGAAGGGATTTGA
TAAAATTGATCAGATCAAGGAGGTGCTCGAAAATGTTTGTCCTGCAGTCGTATCTTGTGCTGACATACTTGCTCTTGCCACTAGAGATGGCGTTGTTCTG
GTATGTTTTACTGCTCCTAC
GAGTCTTGACGTATTCTTTCCTGTTTTAATTAAACAACCTCTAAGGCAAAAATTTCCAGTTTCTTCTCTTTCCATTCCATCTAATTACTATTAGAAAAAAGAACTAAAAGAGAGAAGTAA
GAAACCAAAACTGTCACACATTTAGTTCTTCAACTTTTGGTGCTTGTGAATTAGTTAGCTGTTCACTAACTCTTTCGCTGGTAGTTCCTCATTATTTAAGTGGAAGAGCTACAGAGCACT
TAACTGTATTATCTGATTGCTTGTTTCAGTATTCTTCTCTGAGTGTTTGTCCTATCTAAAATGACAGGCTGGTGGTCCCTTTTATCCACTTTTCACTGGTAGAAGAGATAGTGCCCGCTC
CTATTATGATGAAGCCATGGCTGAGATTCCAAAACCTGATGATAATATCACTCAGACACTTCATCTGTTCTCACTCAGAGGTTTTACTGACAGAGAAACCGTCAGTCTTCTAG
GTACTCA
ACTAACAAATTCTGTTCCTTCTTTTTCTTCATTTCTTTATGTTTTGAGCTGAAATAGATTAATCAGTCTTGACATAATCTTCCCTTCTGATTTTTTTTTTTTTGGTTTTGTTTCATATCT
GTAGGAGGGCACAACATTGGGAAGATTGGATGTGAGTTCATTCAGTCTCGCCTTCACAACTTCAAGGGGACAAGGAAACCAGACCCAACTGTTTCTCCTAGTTTCCTCAATGAGATGAGA
GTTTTCTGTGAAGACAATGGTAACGAGAAGAGTAGCCAAGGATCACCCATGGCAGCTAACATGGCGTCTCCCATGGCATTCCCCACGACAGGCCCCATGGCAGCACCCAT
GGCATCATCC
CCAATGGCATCAAGGGGCATGAATGAGAAGCCTGCGCCGAGGGGGATGCCATACTTTCAGCAACTGTCATCATCTGTATCGTCTGGGGCAGGCTTTGACACTCATTACTACCAGAGCTTG
TTGAGAGGCAGAGGACTTCTCTTTGCTGATCAGCAATTGATGGCTAATGAGAGGACAGCCAGATTGGTGAGAGCTTATGCTTCAGACGATGGATCAACCTTCCGGATGGACTTTGCCCGG
GCAATGATGAAGATGTCTAACCTTAATGCACTCACTGGATCTCAAGGTCAGGTCCGATTAGAATGCACTCTAGCTGGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAGATGACAGATTCTGCTGCAACGAACATCGAGTATGATTTCTACCGCGATACATGCCCTGAAGCTGAGACCATTGTGAGGTCTACGATGGCTCAGATTTACTCCCAGCACAAGAATG
TCTCTGCTCAGCTTCTGCGCCTCTTTTTCCATGATTGCTTCATTCAG
GGTTGTGATGCTTCTGTCCTCTTGGATCACAGCAATGGGAATAAAAACCATTCCGTAGAGAAGCAGGCTGTGC
CAAATAAGAGCTTGAAGGGATTTGATAAAATTGATCAGATCAAGGAGGTGCTCGAAAATGTTTGTCCTGCAGTCGTATCTTGTGCTGACATACTTGCTCTTGCCACTAGAGATGGCGTTG
TTCTG
GCTGGTGGTCCCTTTTATCCACTTTTCACTGGTAGAAGAGATAGTGCCCGCTCCTATTATGATGAAGCCATGGCTGAGATTCCAAAACCTGATGATAATATCACTCAGACACTTC
ATCTGTTCTCACTCAGAGGTTTTACTGACAGAGAAACCGTCAGTCTTCTAG
GAGGGCACAACATTGGGAAGATTGGATGTGAGTTCATTCAGTCTCGCCTTCACAACTTCAAGGGGACAA
GGAAACCAGACCCAACTGTTTCTCCTAGTTTCCTCAATGAGATGAGAGTTTTCTGTGAAGACAATGGTAACGAGAAGAGTAGCCAAGGATCACCCATGGCAGCTAACATGGCGTCTCCCA
TGGCATTCCCCACGACAGGCCCCATGGCAGCACCCAT
GGGGATGCCATACTTTCAGCAACTGTCATCATCTGTATCGTCTGGGGCAGGCTTTGACACTCATTACTACCAGAGCTTGTTGA
GAGGCAGAGGACTTCTCTTTGCTGATCAGCAATTGATGGCTAATGAGAGGACAGCCAGATTGGTGAGAGCTTATGCTTCAGACGATGGATCAACCTTCCGGATGGACTTTGCCCGGGCAA
TGATGAAGATGTCTAACCTTAATGCACTCACTGGATCTCAAGGTCAGGTCCGATTAGAATGCACTCTAGCTGGCTAG

Retrieve as FASTA