Entry information : RcAPx01 (29805.m001492)
Entry ID 9327
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-02 (Qiang Li)
Peroxidase information: RcAPx01 (29805.m001492)
Name (synonym) RcAPx01 (29805.m001492)
Class Ascorbate peroxidase    [Orthogroup: APx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcAPx01
start..stop
S start..stop
PtriAPx02 361 7e-128 1..248 1..250
CclAPx05 360 2e-127 1..248 1..250
CsAPx02 358 5e-127 1..248 1..250
CroAPx02 356 8e-126 1..248 1..250
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 117870..117988 119 N° 2 117614..117788 175 N° 3 117489..117548 60 N° 4 117306..117363 58
N° 5 117097..117154 58 N° 6 116934..117027 94 N° 7 116480..116584 105 N° 8 116314..116372 59
N° 9 116208..116226 19  
complement(join(116208..116226,116314..116372,116480..116584,116934..117027,1170 97..117154,117306..117363,117489..117548,117614..117788,117870..117988))


exon

Literature and cross-references RcAPx01 (29805.m001492)
DNA ref. Phytozome 12:   29805 (117988..116208)
Protein sequence: RcAPx01 (29805.m001492)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   248
PWM (Da):   %s   27414.32  
PI (pH):   %s   6.4
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKSYPKVSEEYQKAVEKCRRKLRGLIAEKHCAPIILRLAWHAAGTFDVSTRTGGPFGTIRHPLELAHEANNGLDIAVKLLEPIKQQFPILTYADFYLAGVVTVTGGSEIPFHPGRPDKTDPPPEGRLPDATKGQSLTKILLHYLVVRPCYVYIAREGVTWSALDLRDPGLATPSFFITPISSKSNRELLSGEKEGLIQLPSDKALLQDPVFRPLVEKYAADEDAFFEDYEEAHLKLSELGFADAE

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGAGCTACCCGAAGGTGAGCGAAGAGTATCAGAAAGCAGTTGAGAAATGCAGGAGGAAGCTTAGAGGACTCATTGCTGAGAAGCACTGTGCTCCAATAATCCTTCGCTTAGCG
TAACATCTCCACCTTCTACAAGACTCCATGTGGGTGAGTTTTTAAGAGGCTCGTGTATTAGTTTATATGGTTTGTTGCAGATGGCATGCTGCAGGTACTTTTGATGTCAGTACAAGAACA
GGTGGGCCGTTTGGGACGATCAGGCACCCACTTGAGCTTGCTCACGAGGCAAATAATGGTCTTGATATTGCTGTCAAACTTCTTGAACCTATCAAGCAGCAATTTCCTATTTTAACTTAT
GCCGACTTCTATCAG
GTATTTATAGCTCTTCAAGTATTTTGGCTGTTAACAATATGAACATATGATTACAATTTTTACAGTTAGCTGGAGTTGTAACAGTTACAGGAGGGTCTGAGATTC
CTTTCCATCCAGGGAGACCT
GTTTGTAATCAGCTACTCGCCGCTGAGACTTTATTTATTGTTCTTATATGTGTCTGACTGCCTATTTGGATCACCATATCTGACATCTGAAGCAAAGATA
AAACTAAATTCTTGTGTTGATACAGGACAAAACTGATCCTCCTCCAGAAGGTCGCTTACCTGATGCTACTAAAGGTCAGTCTTTCTTTTTTCTTTTTTCTTTTTTCTTTTTTTAAGTCAA
ATGCTCAACATAAAATCATTACAGCGCATAACTGTAACTAAAGTCTATATATATAAGTTGTCTTGCTTTGGGTTCTGATCATCTTAGGGACGTCTTCGGTCGAATGGGTCTTAGTGACAA
AGATATTGTTGCATTATCTGGTGGTCAGACCTTGCTACGTATATATTGCTAG
GTGAGAAATGAGACAAGAATCCTGGCAAATGCCATACATCTTGATCAATGCTCTTGGTTTTTGCTGCA
GGGAAGGTGTCACATGGAGCGCTCTGGATTTGAGGGACCCTGGACTAGCAACCCCCTCATTTTTTATAACTCCTATTTCAAGCAAGTCTAATTTCATCTCCATTGATAATCGGTAATCTT
TCTTTCTTAAAGTTAATTGCCTTAGTCTCTTCTCTTATGTATGTTTATGCATGATGCTCTTGGGTAACTGTATTATTAGAACAACTCTTCATTTGAAATATAATGAGCAGATTATTGTTG
TGAATCTGGACTCTTCAAGGTTGATTGTATGATTAAACGCAAGATCTCAATTAAGTTACATTTCCCAATTAATATATGTAGACAGCTCTGTATTTGGATCAAGTAAAGTTGTGCTCAACT
GTTTGGAGTTTAATCCCACAGGCCTTCGCATCATTGCATGTTTGAAAGTTAAAATAAGCGATATCAATTTTGATACTGTTAATCAGGGAACTCTTGAGTGGAGAAAAAGAAGGCCTCATT
CAGCTGCCGTCAGACAAGGCTCTTCTGCAAGATCCAGTCTTCCGTCCTCTAGTTGAAAAATATGCTGCC
GTGAGTATTTAGCTATATATACAATTTCTTCGCAGCCGTTAGCTACATACA
TCCCGTCAGGTGTAATTATTTAAACTCTGATTGTTATGGTGGTTGCTCTTTATCAGGATGAGGATGCGTTCTTTGAAGATTATGAAGAAGCTCATTTGAAGCTCTCAGAACTTGGGTAAG
CAAAAGATTTTATTTTGTCCTCTTTATTTGCTTTGTTGTTACTTATTCTGAAGTTAACTTAATTTGTCTCCTTTTACTTCAGATTCGCTGATGCTGAATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGAGCTACCCGAAGGTGAGCGAAGAGTATCAGAAAGCAGTTGAGAAATGCAGGAGGAAGCTTAGAGGACTCATTGCTGAGAAGCACTGTGCTCCAATAATCCTTCGCTTAGCA
TGGCATGCTGCAGGTACTTTTGATGTCAGTACAAGAACAGGTGGGCCGTTTGGGACGATCAGGCACCCACTTGAGCTTGCTCACGAGGCAAATAATGGTCTTGATATTGCTGTCAAACTT
CTTGAACCTATCAAGCAGCAATTTCCTATTTTAACTTATGCCGACTTCTATCAG
TTAGCTGGAGTTGTAACAGTTACAGGAGGGTCTGAGATTCCTTTCCATCCAGGGAGACCTGACAAA
ACTGATCCTCCTCCAGAAGGTCGCTTACCTGATGCTACTAAAGGTCAGTCTT
TGACAAAGATATTGTTGCATTATCTGGTGGTCAGACCTTGCTACGTATATATTGCTAGGGAAGGTGTC
ACATGGAGCGCTCTGGATTTGAGGGACCCTGGACTAGCAACCCCCTCATTTTTTATAACTCCTATTTCAAGCAAGTCTAATTTC
AGGGAACTCTTGAGTGGAGAAAAAGAAGGCCTCATT
CAGCTGCCGTCAGACAAGGCTCTTCTGCAAGATCCAGTCTTCCGTCCTCTAGTTGAAAAATATGCTGCC
GATGAGGATGCGTTCTTTGAAGATTATGAAGAAGCTCATTTGAAGCTCTCA
GAACTTGG
ATTCGCTGATGCTGAATGA

Retrieve as FASTA