Entry information : RcAPx02 (29602.m000217)
Entry ID 9328
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-02 (Qiang Li)
Peroxidase information: RcAPx02 (29602.m000217)
Name (synonym) RcAPx02 (29602.m000217)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcAPx02
start..stop
S start..stop
CsAPx03 509 0 1..288 1..287
CclAPx03 508 0 1..288 1..287
GhAPx01 507 0 1..288 1..288
MeAPx08 507 0 1..287 1..287
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 103512..103624 113 N° 2 103736..103860 125 N° 3 103973..104022 50 N° 4 104596..104661 66
N° 5 104739..104787 49 N° 6 112526..112608 83 N° 7 112696..112775 80 N° 8 112870..112972 103
N° 9 113665..113862 198  
join(103512..103624,103736..103860,103973..104022,104596..104661,104739..104787, 112526..112608,112696..112775,112870..112972,113665..113862)


exon

Literature and cross-references RcAPx02 (29602.m000217)
DNA ref. Phytozome 12:   29602 (103512..113862)
Protein sequence: RcAPx02 (29602.m000217)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   288
PWM (Da):   %s   31911.37 Transmb domain:   %s   o259-281i
PI (pH):   %s   7.3
Sequence 329
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLPVVDTEYMKEIDKARRDLRALIAYKNCAPIMLRLAWHDAGTYDKHTKTGGPNGSIRNEEEYSHGSNNGLKIALDFCEEVKAKHPRITYADLYQLAGVVAVEVTGGPSINFVPGRKDSKISPREGRLPDAKQGPPHLRDIFHRMGLCDKDIVALSGGHTLGRAHPERSGFDGPWTKEPLKFDNSYFVELLKGETEGLLKLPTDKALLEDPEFRPYVELYAKDEEAFFKDYAESHKRLSELGFTPSSSGSKVIAKDSVILAQSAVGVAVAAAVVIFSYFYEVRKRMK

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCGTTACCGGTAGTTGACACAGAGTACATGAAGGAGATAGACAAGGCACGTCGCGATCTCCGTGCTCTTATCGCTTACAAGAACTGCGCTCCTATCATGCTTCGCTTAGCGTAACTTA
CTAACCATTCTCTTGGTTCCTTTTTTCTTTCTTTTCTTTAATCGACTGATTGATGAATAAATGGATTCTTGTTGTTGTTGTTGTTGTTGTTGCGTTTGTGAAGATGGCACGATGCAGGAA
CCTACGATAAGCACACAAAAACTGGTGGACCTAACGGCTCTATAAGGAACGAAGAGGAGTACTCTCATGGCTCTAACAATGGCTTGAAAATTGCTCTTGACTTTTGCG
GTCTGTTTTTTT
TTTTATAAAAAAAAATCCTTATTTATGTTAGATTATGTGCATGCACGTATTTAACAATGTCTGTTTTGTTTTGTTTTGTTTTGTTTTTTTTTTTTTATAGAGGAAGTGAAAGCTAAACAT
CCAAGGATTACTTATGCGGATTTATACCAG
GTGATTGTTTATTTAATTATATGTATTTTATTACCTAATTTTTTTTAGTTGCTAATATAGGAGCACAATTCAGCACCTAATCTTTTATCA
TAGCATAAAATTAAATTCAATTGAATTAAATTTAGTAAATTCTTATGGGTGGAAAATCCATAGTTGCTATAATTTAATTCTTTCAACTAAAATTAAAAAAAGAATGGGATTTGGAAAAGG
AATGAAATGATGCCAAAAAAATTGATGTGATTTTGCAAGAATTTGATTCTTAGGTATGATTTATTCCAAACAATTGGATATACTGTGGCGTACAACTCCATATTGGTTTTAGTAGTCCAT
CAAGATTTGAGCTCAATACTAGATGATGGATTATTTTTCCATGATTGATTACCTCCCCTAATGAATGGCTTTCACATCTAGTCACTTCTGTGTGACCAGAGAGAAAGAGACCATCTTTTT
GATATTTTAGACTTTAGTGATGATTGTTATTTATTGACATTAATAGCTTTAATACTTGGGAAACTAACATGGGTTTTGCAAATGAGGGGTGAGTTGACTTATAATAGATACTTCTACTTT
TAGCTTGCAGGTGTTGTTGCAGTTGAGGTCACTGGAGGCCCTTCCATTAACTTTGTTCCTGGCAGAAAGGTATCTGATTGTGTCGTTTCTTGAAGTTCTGCCTGCTTGACAGTGTATGAT
ATAATATATTCTTTATTCTCTTTAAGGACTCCAAAATCTCTCCCAGGGAAGGGAGGCTTCCAGATGCTAAACAAGGTATTTTCAATGTTTAACTAATTCTCACTTCTTCCATCTATGAAT
CCATGTGTACTAAGCTTTTATGTTAAGTTCTGTTAATGACAAGTCCTGACTCTCAGAGTTATAGCTTTTCTAAAGTAATGCTGCAAATAATAATCTCTGAACTTCATTACTAAATCTTGG
AGGATGAAGACAGATTATCTATATAACATTAAGGAAGATAGTGTGTTGAACCATTTTTTTTTTTATTTTTTTATTTACTTTTATGCAAGTAGGTGTTGTAGACTAGTAGTGTAACAATTG
ATCATGTGTTGCATTCTTAAGTTTCCTATGTTTAGTTTACATATTTAATAGCCAAAATTGGCAACTGTAACTTGAAATGTTTGTTTGATTGACAAGTTATGTGTGTGTTTGTGTGTGTGT
GTGGTGAGAGAGAAAGAGATTATCCATAGGTTTCAGCCTTTCAGGTCATTTTTCTTGCATGTGGTACAATGTTTAAGCTAGTAAATTACTGCAATGCCCAAGTAATACTTCATTCTTAAT
TGTTATGGAAGTTGTATAAGATCTTATATAGTAATTAGAAGACTAAAATTTAATTAAGAGTCCTAGTTCTACTTAGATTAGGATTGTATATATTGTGTATATATATATATAGGTGTAACT
CCCTTGATTAAAAGAATATAAGATTTTCGGATTCTTCACTCAAATTACAAATTGTATGGTATCAGAGCCTGTTTTGTAGAGAGGGTTCTGGTCCTGCTGCTGCCTAACGTAGCAGCCACC
AATTTTTTTTTTGGGTAACTAAGTTAGGGTGTCTCGGGTCCCCCTTCTCCGGCAGTTTGCTATTCTCACCGCCTGAACCTGGGGAAGCGCCTACCGCCAATCAGCCTATGTCTGAAGTTT
CGTCGCTGGAAACCCTGTGCGTGACTCCCAAGCGCCGCCACAAGCTTTCTGCTACAGTAACACGTGCCGGATGCGTGGAGGTGCGTCTGGAACCGGAAATTGCTCCGGTTTGTCTTGGTT
GACTTCTCTTGACTTCCACAACTTGTTTGTGTACCTGTTTAGGTCAGCATCAGTCATGGTATGAGATTTTTTTAGTACAGGTTTGATTTTTTCGGAAATTTTTTGTAGGCAGAATTTGTT
TTCTATATTTGGATTTGTTCTTCATAAAATATGGCTGAGAAAAAGGCTGTGGTTGTTTCTGATGTGGTTCCGGTGATGTCAAAAATTACGGAATATAAACTTAATGCTACAAATTATCTT
TATTAGCGTCAAACTATTGAGTTATATTTGCTAAATATTTCTATGGATAGCCATTTGACTGATGATCCTCCAAAAGAGGATGCTAGACTACCTTGGATGAGAGAAGATGCTCGCTTGTTT
TTACAGATACGTAATTCTATTGATAATGAGGTGGTTGGTATGGCTACTCATTGTAGGACAGTCAAACAATTAATGAGTTATTTAGAATTCCCATATTTGGAAAAGGGTAATGCTTCTCGA
ATTTATGATGTGTGTAAAGCATTTCATAGGGCGTAGAAAGGTGATAAGTCTCTCACCAACTATTTTATGGATTTCAAGAAAACATATGAAGAACTTAATATGTTGCTTTCATTTAGTAAT
AATATAACTATTCAACAAGCTCAACGTGAAAAGATGGCTGTGATGAGTTTTTTAGACGGACTCCCTTTGGAATTTGAGACTGCTAAATCTCAGAGTCTTTCCAGTTCATAAATTTCCTCT
TTACAAGAGGTTTTTAGTAGAGTCCTTTGTACAGAAAATTCTTCACCTGTTCAGCTTAGTATTGTCCGGGTTAGTCGCAATACTACATATGAATCAGGAAGACAATAATATAAGATCGGG
AATGGTAGTAAAATGATAGTATCTAGCAACTATGACAGGTATACTAATACTTGTGGACAAGAGTCAGGAGAGATAATGTGTCACTACTGTCATAAACTAGGACATATGAGACGAGATTGC
AGGAAGTTGCAGTATAAGAAAACTCAGTCCGCCAATGTTACATCCACCATGGATACCTCTGAGAGGCCTGTAATGGTATCTGCAGATGAGTATGCAATATTTTGTCCAGTACCAAGAATC
ACTAAAAACTCAATCTCCTCCTATTACTACCATTGTTGAATCAGGTAAATCCAATACATGTCTTGTTTCCTCCTCTTCGAAATGGGTCATTGATTCTGGTGCTATAAATCATATGACAGG
TAATGCAAAATTATTTTCTACCTTTCAGTCACATAAATCTACCTCTCCAGTTACTTTAGCAGATGGGTCAACATCTTGTGTTATTGGGTCTGACACAATTAATGCCACACCGTCATTTTC
TTTATCATCAGTTCTTAGTTTATCACAACTATCATTTAATTTAATTTATGTAAGTAAACTCACTCACAGTCTTAACTGTTGTCTCATTTTTTCCTGATCATTGTTTATTTCACGATCTTA
CGACGAAGATGATTATTGGTAAGGGACATGAGTCTGGGGGTCTCTACATTCTTGATACACAAATTGCAAGATCTATAGCCTATTTTGGAGTGATGACACATTGTAGGTTGGGCCACTCAT
CTCTCCATGTGCTAAAACAACTTTGTCTTCAGTTTCAGAGTCTGTCTTCATTAAATTGCGAGTCTTGTCAGTTTGCTAAACATAATCTTCTTAGTTCAAGTCCTAGAGTCAATAAACGAG
CTAGTGCTCCTTTTGAGTTAGTCCATTCAGATGTTTGGGGTCCATGTTCCATTGAGTCCAAAACTTGATATAAGTATTTTGTTACTTTTATTGATGATTACTCTCGTATGACATTGTTAT
ATTTAATGAAAAATTATTCGGAGGTGTTTTCTCATTTTTCTACTTTTTGTGCTGAAATTACAACATAATTTAATATTTCTGTACAAATATTGAGAAGTGATAATGCTAAGGAGTACGTAT
CAGAATCCTTCCAAACTAAAACACTGATTCCTGTTGAGCCTAGGATATTTGGGTTTACATTCTTTGTTTGGGATGTTCGTACTCTGGTTACCAAGCTAGATCCAAAATCTTTGAAGTATG
TTTTTCTTGGCTATTTTCGTGCTAAAAAAGGATATAGATGTTACTGACCTTCTTTTAACAGATATCTTGTTAGTTGATGTTACTTTTTTGGAAGATACACCTTTCTTTCCATCTACTCCT
CCTTTAAGTCAGGGGGAGGATGGGGATTTTGTAATTTATACTGTTACACCTACTCTTGATAAACCTAAGCCACCTATAGTACAAGTTTATTCTCGGCGATCAACCCCTCCGGATCCATGT
TCTGAACCAACTCCTTCGTTGTCAAATCCAGTCTCTAATGATGATCTTCTTATTGCTCTTTGTAAAGGTAAGCATACATGCACTTATCCAATGTCTTCCTTTGTGTCTTATAATCAATTG
TCGTCCTCCTCTTCTTTTATTGTATCTCTAGATTCTATATATATTCCTAAGGCTGTTAAAGAAGCCCTTTCTCACCCTGGTTGGCTTAATTTAAGGAGATGAGTGCTTTACAGGATAATG
GTACTTGGACCTTAGTTGATTTGCCTGCAGCTAAGAAAGCTATTGGGTGTAAATGGGTATTTGCTATTAAAGTCATTCTTGATGGATCCATTGCAAGATTAAAAGCCCGTCTTGTTGCTA
AAGGATATGCTCAAACTTATGGAGTAGATTATTTCGATATATTTTCTCCTGTTGCTAAGATGACTTCCATAAGATTGTTTATTTCTATGGCGGCTACTTATAATTGGCCTCTTCATCAAT
TAGATATCAAGAATGCTTTTCTCCATGGGGATCTTCAGGAGGAAGTTTATATGGAGCAACCGCTTGGCTTTGTTGCTCAGGGGGAGTATGGGAAAGTTTTCTATCTTCGCAAGTTTCTAT
ACGGATTGAAGCAAAGGCCTCGTGCTTGGTTTGGAAAGTTTAGTCAAGCAGTTGAGAAGTTTGACATGAAGAAAAGTAAGTTGGACCATTCTATTTTCTTCAAGCATTCTGCTGTAGGTA
TCATTCTGTTAGTTGTGTTTGTGGATGATATTGTCATTATTGGGAGTGGCACTACAGAGATTTCATCCCTTAAATATTTTCTCCACATTCAGTTTCATACTAAATATTTGGGAATGTTGA
GATACCTCTTGGGTGTTAAGGTAATACGAAGTAAGAAGGGAATATTTTTATCTCAAAGGAAATATGTACTTGACCTGTTGTCCGAGATAGGAAAGTTGGGAGCTAAGCCATGCAATATTC
CAATAGTTCCTAATTTGCAGCTCACAAATGATGATGAGTTATTTAAAGATCTTGAGAGATATAGAAGATTGGTTGGGAAGTTGAATTATCTTACTGTGATTCGTCCAGATATTGCATATT
CAGTTAGTGTGGTGAGTCAGTACATGTCCTCTTCAACAGTTAATCACTGGACAACTGTCGAACAAATTTTGTGCTACTTAAAAGGAGCACTTGGGCGAGGAATATTATATGGTAATCATG
GTTATAATAGAATTGAATGTTTTTCAGATACTGACTGGGCGGGTCTAAGGATGATTGAAGATCTACTACAAGCTATTCTGTATTTGTTGGAGGGAATTTGGTTTCATGGAAAAGTAAGAA
GCAAAATGTTGTCTCACGTTCAAATGCGGAATCAGAGTATAGAGCTATAGCCAAGTCAATATATGAAATAATGTGGATATACATCTTTTAACTGAAGTAGGACTTAAAACTTCAGTACCG
GCTAAGTTGTTGTGTGATAACCAAGCTGCTCTTTACATTGCATCAAATCCTGTATTTCATGAACGAACTAAGTATATCGAGATTGACTTCCATTTCGTTCATGAGAAGATTCAGCAAGGT
TTGATTTCCACAGGTTATGTTAAGACAGGAGAACAACTAGGAGATACTTTCACGAAGGCTCTTACTGGGATTCGAGTTTATTATCTCTGTAACAAGCTGGACATGATTAATATTTATGCT
CCAGTTTGAGGGGGAGTGTTATGAAAGTTGTATAGGATTGTATATAGTAATTAGAAGACTAATTTAATTAAGAGTCCTAATTCTACTTAGATTAGGATTGTATATACTGTGTATATATAT
ATAGGTCTAACTCCCTTGATTAAAAGAATATAAGATTTTCGGATTGAATATAAGATTTTCGGATTCTTTACTCACGTTACAAATTACATTATTAAAGGGTCCAATTAGTAGTCGAAGTAC
TTGCTGCATCTCTTCTCTACAAGTTGGTATACTCCTTCCCCTCCTGTTGTTTCTGGTAAAAGGGCATGATATACTGAGGTTGTTAATATGTTTGATCAAGGAACTTTAAGGATTCATTAA
TTCAGGCTCAAAGCCTGCTTTACTCTTTTAATCTTAGTTCAAGAAATTCATTCTATATTTATCATTCAGTTGCCACTTGCTTTACATTTTGACTAGAATATATCTCTATATTGATCTCAT
TTATCACAGGCTCACAGCTTCAGTTCTATATTATATAGATACTTCAGTTTGCTAAGTATGATATTTGTGCTCACATGTTTCAGGCTTGTTTTGCAGTCTACTGTTTCTAAATAGGACCAC
AATTGCTTAACCTGACCTCATGTCTGTGTGGGCTTATGTTGACACCTCTACTGTCAATGCTTTACCTGAGTCCTCTTGTACTTGTGGATTCAGATGAAAAAGAAAGTTTCTTCTTAGTAC
TTTAAGTCTTGATTTCTGTAATGGGTCCCATCCAGATTCTGCCGATATCGTTGCTTGTTTGTATAGCAGTTGAAATCAAGTGACTGAAATCTGATGTGCACAGTCATACTTGATGCAGGA
ACTCTGTCTAACCAAACCTCAAGGGCTTAGCTCAAGTCGAGGCTTGGATTTGGTTAAGTTAAATACTTGGAACACCTTTATATCCTAATATGTCCTCCTGTGTGTGTTGGAAATGTTCTT
AAGTTGCTGTGTTGCTCATTGTTGTCTAGAACTTCAGCGTTTTATCATTCTTTTTCTAAACGGGACATAGAGCACGCTGAAATATCCTGCAACTTGAATTGTTGTTTAAAGGTCTTAATA
TCCTATTCACAAATGTGCAGCTGCATCAAGAAGTTGCCTATGGAATTCTACTTAGGAGATGGGTATAGTAGATTTCTATTTAAAATTTCAGGATTGGTTTCCTATTAATATAGGGATCTA
AGCTTCAAGAAATACAGACTTTAGTTCAAGCTAATCAGAGTGAAAGGCAGCAGTTAGGGGTTTGCAAATTGCACTCTCAATTGGATCAACAATAAACTGCAATATCATCAAAACTTACAT
ATTATTGGAGATTATTCAAAATGTCTGCTAACATTGCTAACAAAAATATTAATACTAATAGATGAGGGGTTCATATTAGATAAGACTGAAAGCATATTGGTTGGAACAGTCTCTTGGTCT
TACTCTTTGTGAATTTGCTGTTTCGAAATAGTCTTATCATTGAGATGGGGTTGTGAAACAATTTAGAGGTCTAACTTTGTAATTAATTTTATTCATTTATATCTAACACATCTCAAGAGA
CTTAATATTGTGAGAAAGCATCAGGTAAAGCAGTAGAAAATAACATAATACTTTGGTGTTTGACTAATAGGAAACATAAGAAAATTCCAACTATTCCTAGTTTACAGCATTTAGTCTCTC
TCTATTGTGATATTTCTTGCAACCAGAGTTGAGTGGAAGTTTGAGTTTTTCGCTTTTTTCTAGCTGCATTCCCACTATTTTCCCTCTTTCAAGAAAGTCAAATGATCAAAGCAGTTCAAT
CAGTTAAATGCTTGTTTCCCCTTAGGATGCTATAAATACAAGATCTATTTTGGTTTACAGGGCTATCCCTTGTATTCCTAGCCTAACTGGAATTCTTGACTTCATAAGACATTAATAGTC
CCTCACACGAGGATATATATTTATATTTATATATTTTAAATATTTGGGAATTGAATTCTTATATATTGTAAGCATTAAATAAGAACTAGTTGTCTACTTCTGCAGCTTCTATATTTTAAT
TTTCTTTTTTGGATTTGGCATTGAAATTTTTGTTGATTATTACTGTACATAATAATTGTATAACAATGGTTTGTGGTATTAATTTTGTTGAATCATGTTAAAGGGAGGAAAATAAGTAAG
AAATGAGTATTTTATATTATGTCATTGACCGAGAAATATTAAAATTGTTTCTCGGAGAGGAAAATTAAACTAGGTGTTGTTTGAGGATAGAGAAAAGGCCTCGGAAAGTTAAATTAGGCA
GTGTTCATTTATTACTGTGTATCTGAGGGTTCTTTCATGCCTACTCCTAAAATGCATATAAACTTTATAGTTGGTAGGAGTGTTCTTGCAAATCTGTTCAGTTATCTCATACAATGCAAA
TATTACTACTGCGTTTTGGTAATTTTCTTTTAAAAGTTACTTTCTAAGGATTATTAGTCAGTGTTATCAAATAGTTGCCATACAATTGCCGGAATCGATATTGTTTATCCTTCATATAAT
TTATCAGTTGAAACTCTTCAGTTGAGTGCAAAGTCATAGAAATACAATGTTGATCTGTGGCTCCGGATTTCAGAAAGTAGATTTCATGTATTAAGCAATTTTATGCTAATGCTCTTTTTT
TTGTTTCCATTCTGTAACCTAGTGTTAAAGGATTCTTAAGAGAAGTACTTCCATATCATGCATAGTTGTGTAGGCCTGTCTGTAAGCTATATGTTTTTGCGTGCAACTAAGCAGGGTCTG
AATTTTATGGTAGGTCCACCACATTTAAGGGATATCTTTCACCGAATGGGTCTGTGTGACAAAGATATAGTGGCACTCTCAGGGGGTCACACTCTGGTACTTATCATCTAATAGCTGTTT
TTATCTAGTTGGTAATCAGTTATATACAAAGATATAATTGTTTTGTTGGCTATTATTATATAGGGAAGGGCACATCCCGAGCGATCAGGTTTTGATGGCCCTTGGACCAAGGAGCCTCTG
AAGTTTGATAACTCGTATTTTGT
GTAAGATTTGAACCGAGAGTAGCAAAATGTTTCACCCTTTGTTATAGAATCTATGAATTCAAATTTATCTATCTGCATTTATTGGCGGTTTTAGGGA
ACTGCTGAAGGGGGAGACAGAGGGGCTGTTGAAACTTCCAACTGACAAGGCTTTGTTGGAAGACCCTGAGTTTCGTCCTTATGTTGAGCTGTATGCTAAG
GTAAAAAGAGATTCTACTTT
AATTATAAACCAATATTTACTGTGTGATTGTTAAAATTCGACCATGTGGTGACATTCAGAATTACAATTAGCATGGACATATAAAAACTGTTTGTGTCTAATTTTTGCATCTAATATTTT
TAGCTTCACCTATTAGGAGGTTTACTGTCATACTGTAGTGGGATTGTCTAATCTACTCATGACATGCAAAAACCAATCGACTTGGAATAAATAAAATTGGGATCAGTTTGAAAAAGTAAA
TTATGATGAGCCAGTGTTCAGATAAGTTATTTTAGTTCCCTGCCAACCTCTGCAAGGTGTTTCTTTTCCATGCAAAATGGGTGGAGATTAGAGCTGATTTGGTTAATGTGAATCTGCCCC
TGTCCTTCTCAGCATGAGTTTATATTCCTTTTTCTGGAACATCTCAATGTTTCTGTTAGTTTGAGAGGACAGGAAGTAGGAAGGGTGAATTTTGATTACATTATGATTAGGTGCAAAATA
GGAGGGAAACATACATAGTCTATATACTGTTTTCGAAATTCTAATCCATGCCCTTTTCCAGCCTCCTAAACCAAACATAGCCTAAATGTGACCTAGAATCATATGTAATAAATACACAAA
TCTTGGGTTGGTGTATATCCTGGTTCATAATATGTAGCATAATTTCTTTTATGCAAATTTGGTGGATGCCAGGATGAGGAGGCGTTTTTTAAAGACTATGCAGAATCACATAAGAGACTT
TCAGAACTGGGGTTCACCCCAAGTTCCTCTGGATCCAAGGTTATTGCAAAGGACAGTGTAATATTGGCGCAAAGTGCAGTTGGGGTTGCAGTTGCTGCTGCCGTTGTGATCTTTAGCTAT
TTCTATGAAGTTCGCAAAAGAATGAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCGTTACCGGTAGTTGACACAGAGTACATGAAGGAGATAGACAAGGCACGTCGCGATCTCCGTGCTCTTATCGCTTACAAGAACTGCGCTCCTATCATGCTTCGCTTAGCATGGCACG
ATGCAGGAACCTACGATAAGCACACAAAAACTGGTGGACCTAACGGCTCTATAAGGAACGAAGAGGAGTACTCTCATGGCTCTAACAATGGCTTGAAAATTGCTCTTGACTTTTGCG
AGG
AAGTGAAAGCTAAACATCCAAGGATTACTTATGCGGATTTATACCAG
CTTGCAGGTGTTGTTGCAGTTGAGGTCACTGGAGGCCCTTCCATTAACTTTGTTCCTGGCAGAAAGGACTCCA
AAATCTCTCCCAGGGAAGGGAGGCTTCCAGATGCTAAACAAG
GTCCACCACATTTAAGGGATATCTTTCACCGAATGGGTCTGTGTGACAAAGATATAGTGGCACTCTCAGGGGGTCACA
CTCTG
GGAAGGGCACATCCCGAGCGATCAGGTTTTGATGGCCCTTGGACCAAGGAGCCTCTGAAGTTTGATAACTCGTATTTTGTGGAACTGCTGAAGGGGGAGACAGAGGGGCTGTTGA
AACTTCCAACTGACAAGGCTTTGTTGGAAGACCCTGAGTTTCGTCCTTATGTTGAGCTGTATGCTAAG
GATGAGGAGGCGTTTTTTAAAGACTATGCAGAATCACATAAGAGACTTTCAG
AACTGGGGTTCACCCCAAGTTCCTCTGGATCCAAGGTTATTGCAAAGGACAGTGTAATATTGGCGCAAAGTGCAGTTGGGGTTGCAGTTGCTGCTGCCGTTGTGATCTTTAGCTATTTCT
ATGAAGTTCGCAAAAGAATGAAGTAG

Retrieve as FASTA