Entry information : RcPrx10 (28333.m000582)
Entry ID 9341
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx10 (28333.m000582)
Name (synonym) RcPrx10 (28333.m000582)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx10
start..stop
S start..stop
PtPrx29 540 0 1..327 1..327
PtPrx28 539 0 1..327 1..327
MePrx106 538 0 1..327 1..328
RcPrx62 530 0 1..327 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 263354..263575 222 N° 2 262954..263142 189 N° 3 262699..262864 166 N° 4 262087..262493 407
complement(join(262087..262493,262699..262864,262954..263142,263354..263575))


exon

Literature and cross-references RcPrx10 (28333.m000582)
DNA ref. Phytozome 12:   28333 (263575..262087)
Protein sequence: RcPrx10 (28333.m000582)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (302)
PWM (Da):   %s   35874.48 (32952.8)  
PI (pH):   %s   8.71 (8.71) Peptide Signal:   %s   cut: 27 range:27-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFQKLLSLVFSQLVLTLLFLDLSNSQGLQLGFYRKTCPNAEYIVHDIAYKYISRDPTLAAPLLRMHFHDCFVRGCDGSVLLDSTKKNQAEKAAIPNQTLRGFNVIDAIKFELERRCPGIVSCADILALAARDSVLMIGGPSWSVPTGRRDGRVSISSEALNQLPSPFANINQLKQNFASKGLSVKDLVVLSGGHTIGIGHCFIISNRLYNFTGKGDTDPSLDPLYAAQLKKKCKPGNSNTIVEMDPGSFKTFDEDYYTVVAKRRGLFQSDAALLNDIETSTYVKLQALTNGITFAQDFANSMVKMGHIGVLTGNQGEIRKQCAFVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTCCAAAAGCTTCTTTCGCTTGTCTTTTCTCAACTGGTTCTCACCCTTTTATTCTTAGACCTTAGTAATTCACAAGGGTTACAGCTCGGGTTCTATAGGAAGACATGCCCAAAT
GCAGAATACATTGTTCATGATATTGCATACAAGTACATCTCCAGGGATCCAACTCTTGCTGCTCCTTTACTAAGAATGCATTTCCATGATTGCTTTGTTAGA
GTATGTTGTTATGAGAAG
ATTATCTTTTATAAATACATGATTAATATATAGCCAGTCCTTGCTATTCTTTTTTTCTGGGCTTTGACTAGGGATCAAACTCTCCTAATATCTCATTTATGAAATGATTATGGTTCCACT
TAATCAAAGCTAATTGGATTTTTATTTGACTAATTAAAAATCTTGCTGTTCTAATTATAAGTAATTGTTGCAGGGATGCGATGGTTCTGTGTTATTAGATTCTACAAAGAAAAATCAAGC
TGAGAAAGCAGCAATCCCCAATCAAACCTTAAGAGGTTTCAATGTGATTGACGCTATAAAATTTGAACTTGAAAGGAGGTGTCCCGGCATAGTTTCTTGTGCTGACATTTTGGCCTTGGC
AGCTAGAGATTCAGTTCTAATG
GTATCAAGTTCTTCTTGCTCAAAATTCATAAGGACTTGCATCATCTTTTACATGCCTATCTTATGTCTAGTAAACCATTTTCCTTTCAGATTGGAGGG
CCATCTTGGAGTGTTCCTACCGGACGTAGAGATGGAAGAGTGTCCATTTCTTCAGAGGCTTTAAATCAGTTACCATCTCCTTTCGCCAATATTAATCAACTTAAACAAAATTTTGCCTCG
AAGGGCCTAAGTGTAAAGGACCTAGTGGTTTTGTCAG
GTAACTATTAATATAATATTATTAGGAAAATGACATGTTCTCTACTTTGTCCATCTTAATAGTTAATAATCTTCCTCGTAATA
CAAGAAATTAATAGTTAAATTAATGGTTACTCCATTCAATTTAAAAAATTAACTACTTCAAATTTTTTTTTTGACAATGCATCATTACAAGATTTTAACTTCTAACTCCTTTGTGTTTGC
AGGAGGGCATACCATTGGAATTGGACATTGCTTTATAATCTCTAACCGCCTATACAATTTCACTGGCAAAGGCGACACAGACCCTTCATTGGACCCCTTATATGCAGCTCAGTTGAAGAA
GAAATGTAAGCCTGGAAATTCCAACACAATTGTTGAGATGGATCCTGGAAGCTTCAAAACATTCGACGAAGATTACTACACTGTTGTAGCGAAAAGAAGAGGGCTCTTCCAATCTGATGC
AGCTCTTCTTAACGATATTGAAACAAGTACTTATGTCAAACTTCAGGCTTTGACAAATGGAATCACTTTTGCACAAGATTTTGCTAATTCCATGGTTAAAATGGGGCATATCGGTGTCCT
TACTGGCAATCAAGGTGAAATCAGGAAACAGTGTGCTTTTGTGAACTAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTCCAAAAGCTTCTTTCGCTTGTCTTTTCTCAACTGGTTCTCACCCTTTTATTCTTAGACCTTAGTAATTCACAAGGGTTACAGCTCGGGTTCTATAGGAAGACATGCCCAAAT
GCAGAATACATTGTTCATGATATTGCATACAAGTACATCTCCAGGGATCCAACTCTTGCTGCTCCTTTACTAAGAATGCATTTCCATGATTGCTTTGTTAGA
GGATGCGATGGTTCTGTG
TTATTAGATTCTACAAAGAAAAATCAAGCTGAGAAAGCAGCAATCCCCAATCAAACCTTAAGAGGTTTCAATGTGATTGACGCTATAAAATTTGAACTTGAAAGGAGGTGTCCCGGCATA
GTTTCTTGTGCTGACATTTTGGCCTTGGCAGCTAGAGATTCAGTTCTAATG
ATTGGAGGGCCATCTTGGAGTGTTCCTACCGGACGTAGAGATGGAAGAGTGTCCATTTCTTCAGAGGCT
TTAAATCAGTTACCATCTCCTTTCGCCAATATTAATCAACTTAAACAAAATTTTGCCTCGAAGGGCCTAAGTGTAAAGGACCTAGTGGTTTTGTCAG
GAGGGCATACCATTGGAATTGGA
CATTGCTTTATAATCTCTAACCGCCTATACAATTTCACTGGCAAAGGCGACACAGACCCTTCATTGGACCCCTTATATGCAGCTCAGTTGAAGAAGAAATGTAAGCCTGGAAATTCCAAC
ACAATTGTTGAGATGGATCCTGGAAGCTTCAAAACATTCGACGAAGATTACTACACTGTTGTAGCGAAAAGAAGAGGGCTCTTCCAATCTGATGCAGCTCTTCTTAACGATATTGAAACA
AGTACTTATGTCAAACTTCAGGCTTTGACAAATGGAATCACTTTTGCACAAGATTTTGCTAATTCCATGGTTAAAATGGGGCATATCGGTGTCCTTACTGGCAATCAAGGTGAAATCAGG
AAACAGTGTGCTTTTGTGAACTAC

Retrieve as FASTA