Entry information : RcPrx11 (28644.m000901)
Entry ID 9342
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx11 (28644.m000901)
Name (synonym) RcPrx11 (28644.m000901)
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx11
start..stop
S start..stop
RcPrx47 577 0 20..354 19..353
EcPrx01 568 0 7..354 1..347
MePrx09 567 0 9..354 6..351
PtPrx67 521 0 1..353 1..353
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 39200..39448 249 N° 2 38928..39122 195 N° 3 38211..38828 618  
complement(join(38211..38828,38928..39122,39200..39448))


exon

Literature and cross-references RcPrx11 (28644.m000901)
DNA ref. Phytozome 12:   28644 (39448..38211)
Protein sequence: RcPrx11 (28644.m000901)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   354 (326)
PWM (Da):   %s   38670.45 (35810.0)  
PI (pH):   %s   7.39 (7.44) Peptide Signal:   %s   cut: 29 range:29-354
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASAKSMASLLGISSLLLLAFCFCTTEAQSRPPIVNGLSWTFYRSSCPKLEFIVRKELQKIFRKDIGQAAGLLRLHFHDCFVMGCDGSVLLDGSAGGPSEKSELPNLSLRKESFKIVDDLRARVHRRCGRVVSCSDIVAVAARDSVFLTGGPDYNVPLGRRDGVKFAETNATFEHLVAPFANTTTILDKLARKGLDATDAVALSGGHTIGISHCTSFTDRLYPSQDPTLDNTFANGLKQTCPQAETHNTTVLDIRSPNIFDNKYYVDLINRQGLFTSDQDLYTDARTRAIVTSFAANETLFFQKFVLSMIRMGQMDVLTGNQGEIRANCSARNSDSKYLVSVAEENLGSSSEMR

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGTGCCAAATCAATGGCTTCTCTCCTCGGGATCTCTTCTCTCTTACTACTAGCTTTTTGCTTTTGCACCACTGAAGCACAAAGCAGACCACCTATAGTGAATGGTCTATCATGG
ACATTCTACAGATCTAGCTGTCCTAAACTTGAGTTCATTGTCAGGAAAGAGCTCCAGAAAATCTTCAGGAAGGACATTGGTCAAGCTGCTGGCCTGCTTCGTCTCCACTTCCACGACTGC
TTTGTTATG
GTAACTATTTTCTGCACTTGATTATGTTCTTGAGCAAACTCTGTTCTGGATGCATATAAAATAAACATATAATATAGGGATGCGATGGATCAGTGTTGCTGGATGGATCAG
CAGGTGGGCCAAGTGAGAAATCTGAGCTTCCTAACTTATCTTTGAGAAAAGAGTCTTTCAAAATCGTCGATGATCTCCGAGCGCGTGTTCATAGGCGGTGTGGCCGTGTGGTCTCTTGCT
CCGATATTGTTGCAGTCGCTGCTCGTGATTCTGTTTTCTTG
GTAAACAAACACCTTCCCGCCATTCCTTTTCTTTTATCTTTTTCTTTCTCTTTTATTGTTCTATATCAATGAAATAGAA
TTATGTTCTTCGGGTTACAGACAGGTGGACCTGACTATAATGTCCCACTAGGAAGGCGAGATGGAGTAAAATTTGCAGAAACAAATGCAACTTTTGAACATCTAGTTGCACCTTTTGCTA
ACACGACAACAATTCTTGACAAGCTTGCAAGAAAAGGGCTTGATGCCACTGACGCAGTGGCACTATCAGGCGGCCACACTATTGGCATTAGCCACTGCACATCCTTCACCGACCGGCTAT
ACCCATCACAGGATCCCACTCTGGACAATACTTTTGCTAATGGTCTGAAGCAGACGTGCCCACAAGCAGAAACACATAATACCACAGTCTTGGACATCAGGTCTCCTAACATATTTGATA
ATAAGTACTATGTAGACCTCATAAACCGTCAGGGTCTGTTTACATCCGACCAAGATTTGTACACGGATGCAAGGACAAGGGCCATTGTTACTAGCTTTGCTGCTAACGAAACTTTGTTCT
TTCAGAAGTTCGTGCTTTCCATGATCAGAATGGGGCAAATGGATGTGCTGACAGGCAATCAAGGGGAGATTCGTGCCAATTGCTCCGCGAGAAATTCTGATAGCAAATATCTGGTGTCTG
TTGCAGAAGAGAATCTGGGTTCATCTTCTGAAATGAGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGTGCCAAATCAATGGCTTCTCTCCTCGGGATCTCTTCTCTCTTACTACTAGCTTTTTGCTTTTGCACCACTGAAGCACAAAGCAGACCACCTATAGTGAATGGTCTATCATGG
ACATTCTACAGATCTAGCTGTCCTAAACTTGAGTTCATTGTCAGGAAAGAGCTCCAGAAAATCTTCAGGAAGGACATTGGTCAAGCTGCTGGCCTGCTTCGTCTCCACTTCCACGACTGC
TTTGTTATG
GGATGCGATGGATCAGTGTTGCTGGATGGATCAGCAGGTGGGCCAAGTGAGAAATCTGAGCTTCCTAACTTATCTTTGAGAAAAGAGTCTTTCAAAATCGTCGATGATCTC
CGAGCGCGTGTTCATAGGCGGTGTGGCCGTGTGGTCTCTTGCTCCGATATTGTTGCAGTCGCTGCTCGTGATTCTGTTTTCTTG
ACAGGTGGACCTGACTATAATGTCCCACTAGGAAGG
CGAGATGGAGTAAAATTTGCAGAAACAAATGCAACTTTTGAACATCTAGTTGCACCTTTTGCTAACACGACAACAATTCTTGACAAGCTTGCAAGAAAAGGGCTTGATGCCACTGACGCA
GTGGCACTATCAGGCGGCCACACTATTGGCATTAGCCACTGCACATCCTTCACCGACCGGCTATACCCATCACAGGATCCCACTCTGGACAATACTTTTGCTAATGGTCTGAAGCAGACG
TGCCCACAAGCAGAAACACATAATACCACAGTCTTGGACATCAGGTCTCCTAACATATTTGATAATAAGTACTATGTAGACCTCATAAACCGTCAGGGTCTGTTTACATCCGACCAAGAT
TTGTACACGGATGCAAGGACAAGGGCCATTGTTACTAGCTTTGCTGCTAACGAAACTTTGTTCTTTCAGAAGTTCGTGCTTTCCATGATCAGAATGGGGCAAATGGATGTGCTGACAGGC
AATCAAGGGGAGATTCGTGCCAATTGCTCCGCGAGAAATTCTGATAGCAAATATCTGGTGTCTGTTGCAGAAGAGAATCTGGGTTCATCTTCTGAAATGAGA

Retrieve as FASTA