Entry information : RcPrx30 (29772.m000315)
Entry ID 9358
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2014-05-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-05-22 (Christophe Dunand)
Peroxidase information: RcPrx30 (29772.m000315)
Name (synonym) RcPrx30 (29772.m000315)
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx30
start..stop
S start..stop
MePrx22 572 0 1..329 1..328
PtPrx59 571 0 1..329 1..330
MePrx63 568 0 1..329 1..327
PtPrx35 566 0 1..329 1..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 73571..73774 204 N° 2 73198..73389 192 N° 3 72087..72672 586  
complement(join(72087..72672,73198..73389,73571..73774))


exon

Literature and cross-references RcPrx30 (29772.m000315)
DNA ref. Phytozome 12:   29772 (73774..70411)
EST ref. GenBank:   EG670940.1 [3' end]
Protein sequence: RcPrx30 (29772.m000315)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (311)
PWM (Da):   %s   36254.09 (34389.1)  
PI (pH):   %s   4.97 (4.97) Peptide Signal:   %s   cut: 19 range:19-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSLLTAFLLLITAMTSAAPLPLRAGFYSETCPEAEIIVRNFMMKALIKEPRSVASVMRFQFHDCFVNGCDASMLMDDTPSMLGEKLSLSNINSLRSYEVVDEVKEELEKVCPGTVSCADIIVMASRDAVALSGGPDWEVKLGREDSLTASQEDANNIMPSPRSNASFLIDLFAKFNLSVKDLVALSGSHSIGQGRCFSIVFRLYNQSGTGKPDPTIEPRFREKLEKLCPIGGDENVTGNLDSTPVVFDNMYFKDLVAGRGFLNSDQTLYTYPETRKYVSFFSKDQSAFFKAFVEGMIKMGDLQSGRPGEIRTNCRVANRRPVDILLES

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2) and ESTs. Incorrect prediction from Phytozome (3' end is missing due to 'NNNN' in DNA but predicted as complete). Completed with EST
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATTATTTATA GGTCTCATAA TTGTTTGTGC CTAACCAATT TTACCAAAGG TGGTTATGCA GTTGTGTATT TTCAAAATCT TTTTGCTAAA AATTGAATTT TGAATCATAA AACAGCACCA  TAATTATTCA TTTTACATAG CCTAAATTTC TTTTCTTTCA TTAAAAAAGA AAATAAAAAT TAAAGAGAGT TTTCTCCTTC TTTTGCTTTC TTTCAATCTT TTCATTCCAT ACAGTTTGTA  CTCTTTTTTC AATGTAGAAA TCATTATAAT TTTTCATCCA ATTTTAATAG ATCATTTTCA ATTTACACAA GAATTTAAGA AATTTAAAAT TTTTCAATTA ATATTACCTT TTTTAACTAT  TTTCTTACTA AAATACGTCT AGGAGTCATC CGGATTGAGA AATTTTATAA AATCTATGAA TTTAGCTTAA ATTCATTGTT TGACAAGTAA ACAAATAATC TAATCCATAA ATTTTGAAAA  ATATTTCATC CTCCAAATTT TTTTATTTTT AAAGGTTTTA ATTTTCTACC TAGAAAGTGA AAAGGTTCAA AATCCATCAT TTTAAAAGAA TGATGGATTA TTATAATATA TTTTTATTCT  AATAATATTT CTAATAAAAT TATTTTATCT TAAAATTTTC TTTAACTTTA CACAAAAATT TATTATTTTT ATATTTAATT CAAATAATAA AATTTTAAAA TTTATAAATT TTAAATCTAT  AAATTTTAAT TAAATCTATG AATTTCAAAA TCTCTCAATC CCAACAACAC CTTAAATCTT TTAATACATT CGCAAACTTT TTAAATATAT TGGGCAATGT TTGTCAACTC ATTTATAATT  TTTAAAATTC AATAAAAGCA CATTTATATT GCAATACAAA AAAGTTTATA TAGTAATATA CAATTTCAAA ATTAAAAAAG TGAAAAATGA ATTATATGTG ATGATATTTA AGTTAATTAA  TGAAGAATAT TTTAAATATT nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn  nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnACCCAC  ATCCTTTTTT CTATGCCCAT CAAATAGACA TAGAAAAAGT TAAAAAAACT AATGAACAGA AAACAAATAA TCATCCTGAA ACTTTTTGTG TTGTTTAGAA TCAGGTCCTT TATTTTGATT  GTATTTAAAT GATTCCTACT TTCTTCTTTT TAAGTATTGC GAACCTTTTA ACACCTCAAA TCCCCTAAAC GATGTCAAAA ACATTATTGT TTGGCCAAAT TCATATTATC TTTTATGAGC  TCTTTCTATT TTTCCTTCAT TCTGTAATTT TTTTATGTGT TATTGAATTT TTAAATAGTT TTTTTTTTTT AAATTTTTCT TAACAAATCA ACACTGTTTT GTGTATTAAT CACTTTTCGC  ACCATTTGAA ATTTATGTGC GTTTGAGATG TTAAAAAGTC CATAACACTG AGAAAATAAA AACCATGGAT CATTTAAAAC ATAATTAAAT GCTAAGAACC CAGTGCCCAA AAACAGGGAT  AATTCAAGGA CTATAAAAAT AGGGTTTTTT TTTTTCCTTT CCAAATTTAA TCACCCCCAT GACATGCCAT CCATGGATGA TAAAGCTCTC TATTCATTAC ATTATATGCA TACATACATG 
AACCCAACAA GTTATATAAA GCCTATAGAA AGCACCAAAA ACAGACCACA TCTCTCAATA CTATCAACTG CTGCCCAAAA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCTCCTAACAGCCTTTCTCCTGCTCATAACAGCCATGACCTCTGCAGCGCCACTGCCACTCCGGGCAGGATTCTATTCGGAGACGTGCCCGGAAGCTGAAATTATAGTGAGGAACTTTAT
GATGAAGGCTTTGATTAAAGAACCAAGAAGTGTTGCCTCGGTTATGCGCTTTCAGTTCCATGATTGTTTCGTTAATGTAAAAAG
AAACAAACTTATAGTGCAAAAGCAAAACGCTCTTTA
TATATATATATATAGAGATATAAAGTTTATTTTCTCTCTTTTTCATAAAGATCATTATTCTTGATTCTTTCTTGATTTGATTATCAAATTTTTTTTGAATCTTTTTTGTTTTTTGTTTTT
CTGAATCTGTTATAAAGGGTTGTGATGCTTCTATGTTGATGGATGATACACCAAGTATGCTAGGAGAGAAGCTTTCTCTTTCCAATATAAATTCTTTGAGGTCTTATGAAGTTGTTGATG
AAGTCAAGGAAGAGTTAGAGAAGGTCTGTCCAGGAACTGTTTCTTGTGCTGACATAATTGTCATGGCCTCGAGAGATGCTGTTGCTCTGGTAATTCT
TTTTGTTTGTTTAACTTAGATCT
TTAGTTAATTTATTTATTTATTTTTATTGTTGGTTCTCTTCAATCTTCCTAAGAGAAAAGAATTCATCAATTATGTCAACTTGGCCATATTCTCAAAGAAAAAAGAAAGAAAAAGAAAGA
AAAAAGGCCATAACCGAAAAAATTATTATTATTGGGTCTGAGCTATTGAAGCATTCTCACCGATATTCTGCGATATGGGTCCTCGGTTGTGCAACTTTTGTCAAGTAGTCAGTTATCACA
GCATTTAAAGATAAGACCCGAATAAATAATGAATGATCTTTACAAAAAGTAGTGCATAGCTTACCTAAGTTAACTTGTCAATCAGGGCACTGCCACTGCCACTATTTAGTTACCCTTTTC
ATCTAGCTTAGAAATGAAAGATTCGTAAAAAGGCAATAATTGTTGTCATGAGGAAGCATACATTTTAATAGTGGATGGTTTTGATCATTATCTGAAATGGGTTTTCTTTGTTTTATCAAA
TTGTGTTAATCTAGAGCGGAGGGCCAGATTGGGAAGTGAAGTTAGGGAGAGAAGATAGTTTAACAGCAAGCCAAGAAGACGCGAACAATATCATGCCGAGTCCAAGATCAAATGCAAGCT
TCCTAATAGACCTATTTGCCAAATTCAATCTTTCCGTGAAGGATCTTGTAGCCCTTTCAGGGTCACATTCTATTGGCCAAGGAAGGTGTTTCTCTATAGTCTTTAGGCTATATAACCAGT
CTGGAACCGGCAAGCCTGACCCAACAATCGAGCCAAGATTTAGAGAAAAGCTAGAAAAGTTGTGTCCGATTGGCGGAGATGAAAATGTAACAGGGAATCTTGATTCAACGCCAGTAGTTT
TTGACAACATGTACTTTAAAGATTTGGTTGCAGGCAGAGGGTTTCTTAATTCTGATCAAACGCTTTATACATATCCTGAAACAAGAAAATACGTTAGCTTTTTTAGCAAAGACCAATCTG
CATTCTTCAAGGCCTTTGTTGAAGGAATGATAAAGATGGGTGATTTGCAGTCTGGAAGGCCTGGAGAGATCAGAACCAATTGCAGAGTTGCCAACAGGCGGCCTGTTGATATATTGTTGG
AGTCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCTCCTAACAGCCTTTCTCCTGCTCATAACAGCCATGACCTCTGCAGCGCCACTGCCACTCCGGGCAGGATTCTATTCGGAGACGTGCCCGGAAGCTGAAATTATAGTGAGGAACTTTAT
GATGAAGGCTTTGATTAAAGAACCAAGAAGTGTTGCCTCGGTTATGCGCTTTCAGTTCCATGATTGTTTCGTTAATGTAAAAAG
TGCTTCTATGTTGATGGATGATACACCAAGTATGCT
AGGAGAGAAGCTTTCTCTTTCCAATATAAATTCTTTGAGGTCTTATGAAGTTGTTGATGAAGTCAAGGAAGAGTTAGAGAAGGTCTGTCCAGGAACTGTTTCTTGTGCTGACATAATTGT
CATGGCCTCGAGAGATGCTGTTGCTCTGGTAATTCT
GCCAGATTGGGAAGTGAAGTTAGGGAGAGAAGATAGTTTAACAGCAAGCCAAGAAGACGCGAACAATATCATGCCGAGTCCAAG
ATCAAATGCAAGCTTCCTAATAGACCTATTTGCCAAATTCAATCTTTCCGTGAAGGATCTTGTAGCCCTTTCAGGGTCACATTCTATTGGCCAAGGAAGGTGTTTCTCTATAGTCTTTAG
GCTATATAACCAGTCTGGAACCGGCAAGCCTGACCCAACAATCGAGCCAAGATTTAGAGAAAAGCTAGAAAAGTTGTGTCCGATTGGCGGAGATGAAAATGTAACAGGGAATCTTGATTC
AACGCCAGTAGTTTTTGACAACATGTACTTTAAAGATTTGGTTGCAGGCAGAGGGTTTCTTAATTCTGATCAAACGCTTTATACATATCCTGAAACAAGAAAATACGTTAGCTTTTTTAG
CAAAGACCAATCTGCATTCTTCAAGGCCTTTGTTGAAGGAATGATAAAGATGGGTGATTTGCAGTCTGGAAGGCCTGGAGAGATCAGAACCAATTGCAGAGTTGCCAACAGGCGGCCTGT
TGATATATTGTTGGAGTCCTGA

Retrieve as FASTA