Entry information : RcPrx47 (29863.m001076)
Entry ID 9372
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx47 (29863.m001076)
Name (synonym) RcPrx47 (29863.m001076)
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx47
start..stop
S start..stop
MePrx09 598 0 9..353 6..351
EcPrx01 590 0 8..353 3..347
RcPrx11 577 0 19..353 20..354
NnPrx26 512 0 20..350 25..356
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 260394..260639 246 N° 2 261048..261242 195 N° 3 261347..261964 618  
join(260394..260639,261048..261242,261347..261964)


exon

Literature and cross-references RcPrx47 (29863.m001076)
DNA ref. Phytozome 12:   29863 (260394..261964)
Protein sequence: RcPrx47 (29863.m001076)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   353 (326)
PWM (Da):   %s   38573.82 (35832.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.9 (8.20) Peptide Signal:   %s   cut: 28 range:28-353
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASANSFTSLLLISCLLLAACFSAIEAQTKPPIKNGLSWTFYKTSCPKAESIIRSELKKIFKKDVGQAAGLLRLHFHDCFVLGCDSSVLLDGSAGGPSEKSELPNLTLRKQAFKIVEDLRARLHKECGRVVSCSDIVAIAARDSVVLTGGPEYAIPLGRRDGVKFAEINATFEHLVGPTAKVTEILTKLDRKGLDATDAVALSGGHTIGIGHCTSFTERLYPSQDPTMDKTFANNLKLTCPKLDTTNTTFLDIRSPNKFDNKYYVDLMNRQGLFTSDQDLYTDKRTRSIVTSFAINESLFFEKFIIGMIKMGQLDVLTGNQGEIRANCSAINPKKKYIESVAEEELGSSSEMR

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGTGCTAACTCTTTCACTTCTCTCCTTTTGATATCCTGTCTCTTACTAGCTGCTTGCTTTTCTGCCATTGAAGCACAAACCAAACCTCCCATCAAGAATGGTCTGTCATGGACA
TTCTACAAAACTAGCTGTCCCAAAGCCGAATCTATTATCAGAAGTGAGCTCAAGAAAATCTTCAAGAAAGATGTTGGCCAAGCTGCTGGCTTGCTTCGCCTCCACTTCCATGACTGCTTT
GTTCTG
GTAACTATTCTTATTCTTCTTTCTTTTCTCTACCTTTCTTGTTCCTGCATGTGCTTGCTGAATTTCTTATAATTTCTATAACTTACAGAGTGTTTTACAAAACAGAAAGTCTCA
TGCACTTGCACACACACTTAAATGAGCTTCTAGCTCTTGGTCATAATGCATGCTATATATATCAGTTTCTTGATATTGCTAGCTTCAATTTATCTTGTGCCTTTTACTTGTTTACTTTAT
CTTGACGGTACCTGTAGCTAAGCATATAATGACAGTAAATTCATGTTAAAAGAAACAGCAAATGTAATCTTTTTATTTTTATTTCTATAGCTTTTGTCGCTGTCTCAATAAATTTTTCTT
TTATATTCTTGGTGAGTTGCCGTATTGTTAATGGATATACATGATGAATTATAGGGATGTGACTCGTCGGTGCTGCTTGATGGATCAGCAGGTGGACCCAGCGAGAAGTCTGAACTTCCT
AACTTGACTTTAAGAAAACAGGCTTTTAAAATCGTCGAGGATCTTCGAGCACGTCTTCACAAGGAGTGTGGCAGAGTCGTGTCTTGCTCTGACATTGTTGCCATCGCTGCTCGTGACTCC
GTTGTCCTG
GTGATTAATTAAAATAATGTTACCTGTTAATTATTTTCAAGAAAAAACTCCTGCACTAGGGTAAGTATGATTTGCTAATATTCAAGTTTCTTGTGAAACTGCAGACGGGCG
GCCCTGAGTATGCCATCCCACTGGGAAGGAGAGACGGTGTAAAGTTTGCAGAGATTAATGCAACATTTGAACACCTTGTAGGACCAACAGCCAAAGTTACTGAGATTCTCACCAAGCTTG
ACAGGAAAGGCCTGGATGCTACCGATGCAGTTGCCCTTTCAGGTGGCCACACAATCGGCATTGGCCACTGCACTTCTTTCACTGAGCGTCTCTATCCGAGTCAAGATCCTACAATGGACA
AGACTTTTGCTAACAATCTCAAGCTAACTTGTCCCAAACTAGACACCACCAACACTACCTTCTTGGACATAAGGTCTCCTAACAAATTCGACAACAAGTACTATGTTGATCTAATGAACC
GTCAAGGTCTGTTTACTTCGGATCAAGATTTGTACACGGACAAGAGGACAAGGAGCATTGTTACTAGCTTTGCTATTAACGAATCTCTGTTCTTCGAGAAGTTTATAATTGGCATGATCA
AGATGGGGCAATTAGATGTGTTGACAGGAAACCAAGGGGAGATTCGTGCTAACTGCTCGGCCATTAATCCCAAGAAGAAATATATTGAGTCTGTCGCGGAAGAGGAATTGGGTTCATCGT
CTGAGATGAGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGTGCTAACTCTTTCACTTCTCTCCTTTTGATATCCTGTCTCTTACTAGCTGCTTGCTTTTCTGCCATTGAAGCACAAACCAAACCTCCCATCAAGAATGGTCTGTCATGGACA
TTCTACAAAACTAGCTGTCCCAAAGCCGAATCTATTATCAGAAGTGAGCTCAAGAAAATCTTCAAGAAAGATGTTGGCCAAGCTGCTGGCTTGCTTCGCCTCCACTTCCATGACTGCTTT
GTTCTG
GGATGTGACTCGTCGGTGCTGCTTGATGGATCAGCAGGTGGACCCAGCGAGAAGTCTGAACTTCCTAACTTGACTTTAAGAAAACAGGCTTTTAAAATCGTCGAGGATCTTCGA
GCACGTCTTCACAAGGAGTGTGGCAGAGTCGTGTCTTGCTCTGACATTGTTGCCATCGCTGCTCGTGACTCCGTTGTCCTG
ACGGGCGGCCCTGAGTATGCCATCCCACTGGGAAGGAGA
GACGGTGTAAAGTTTGCAGAGATTAATGCAACATTTGAACACCTTGTAGGACCAACAGCCAAAGTTACTGAGATTCTCACCAAGCTTGACAGGAAAGGCCTGGATGCTACCGATGCAGTT
GCCCTTTCAGGTGGCCACACAATCGGCATTGGCCACTGCACTTCTTTCACTGAGCGTCTCTATCCGAGTCAAGATCCTACAATGGACAAGACTTTTGCTAACAATCTCAAGCTAACTTGT
CCCAAACTAGACACCACCAACACTACCTTCTTGGACATAAGGTCTCCTAACAAATTCGACAACAAGTACTATGTTGATCTAATGAACCGTCAAGGTCTGTTTACTTCGGATCAAGATTTG
TACACGGACAAGAGGACAAGGAGCATTGTTACTAGCTTTGCTATTAACGAATCTCTGTTCTTCGAGAAGTTTATAATTGGCATGATCAAGATGGGGCAATTAGATGTGTTGACAGGAAAC
CAAGGGGAGATTCGTGCTAACTGCTCGGCCATTAATCCCAAGAAGAAATATATTGAGTCTGTCGCGGAAGAGGAATTGGGTTCATCGTCTGAGATGAGA

Retrieve as FASTA