Entry information : RcPrx53 (29983.m003295)
Entry ID 9376
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx53 (29983.m003295)
Name (synonym) RcPrx53 (29983.m003295)
Class Class III peroxidase    [Orthogroup: Prx026]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx53
start..stop
S start..stop
MePrx119 563 0 1..315 6..318
CsPrx05 536 0 5..315 17..326
GhPrx39 534 0 1..315 11..323
GrPrx39 534 0 1..315 11..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1017835..1018050 216 N° 2 1018179..1018367 189 N° 3 1018472..1018634 163 N° 4 1018870..1019246 377
join(1017835..1018050,1018179..1018367,1018472..1018634,1018870..1019246)


exon

Literature and cross-references RcPrx53 (29983.m003295)
DNA ref. Phytozome 12:   29983 (1017835..1019246)
Protein sequence: RcPrx53 (29983.m003295)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   315 (289)
PWM (Da):   %s   34826.92 (31913.5) Transmb domain:   %s   i5-24o
PI (pH):   %s   5.03 (5.17) Peptide Signal:   %s   cut: 27 range:27-315
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANYILGVFFFMEMILSGFRFGAVDGLSMNYYLMSCPFADQIVKNTVTRALQDDPTLAAALVRMHFHDCFIQGCDGSVLIDSTKDNTAEKDSPANLSLRGYEVIDDAKEQLEEQCPGVVSCTDILAIAARDAVFWAGGPFYEIPKGRKDGRRSKIEDTINLPFPTSNASELIRQFGQHGFTAQEMVALSGAHTLGVARCASFKNRLTSADPTMDSDFANTLSRTCSGGDNADQPFDMTRNTFDNFYFNTLQRKSGVLFSDQTLYNSPRTRGIVNAYAFNQAMFFLDFQQAMLKMGLLDVKEGSKGEVRESCRKI

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAATTATATTCTTGGTGTTTTTTTCTTCATGGAGATGATATTGAGTGGTTTTAGATTTGGGGCAGTGGATGGGCTGAGCATGAACTACTATCTTATGAGCTGCCCCTTTGCTGAT
CAAATAGTTAAGAACACAGTTACAAGAGCTCTGCAAGACGATCCTACTCTAGCTGCTGCCCTTGTTAGAATGCACTTCCATGACTGCTTTATACAA
GTACATATATACCTTCTCTCTCTC
TCTCTCTCTTTCACACATACTTACTGCTTCTGCTTCATGTTAATTACGTGTAGTTGGTAAACTCGAAATAGTTTCTGATTATTTGTGCATGTGAAAATTAAAAGGGATGTGATGGTTCTG
TCCTCATTGATTCAACAAAAGATAACACAGCAGAAAAGGATTCTCCAGCAAATCTAAGCTTACGAGGCTATGAAGTCATTGATGATGCAAAAGAGCAACTTGAAGAACAATGCCCAGGCG
TCGTCTCATGTACTGACATTCTTGCAATAGCTGCTAGAGATGCAGTGTTCTGG
GTATGTAATGTCACACTTCCACTTAGTTTTATGCTATTAATTAGAGCACCAACCGAGTAATCTGTAG
TGGATAATATATAATTAATTGTGTGAATTGCATGCAGGCAGGGGGTCCATTTTATGAGATACCGAAAGGAAGAAAGGATGGAAGGAGGTCTAAGATAGAAGATACAATCAACTTGCCATT
TCCCACCTCCAATGCCAGTGAGCTTATTAGGCAATTTGGGCAGCATGGTTTCACTGCTCAAGAAATGGTTGCCTTGTCTG
GTGAGTTAATTATCCTTTAATCATTTCCCAAATCCCTAGT
GTATTACAACTGGCAGTTTTTTACTTCTACTTTACTCAGCCCGCCCAACAAACAGTAATCATTGGTGCTGATTAATCATCGATGCTGATTATATATAGATATACATGTCTACCTACCAAA
TCTCAATGATATGTTACGTATGTCTCACAGTATAATTTATGACTTAATCATCCAATCACGCATTTGGTCGTGCAGGAGCACACACGCTAGGAGTGGCAAGGTGCGCATCATTCAAGAACA
GACTGACTAGTGCTGATCCAACAATGGATTCAGACTTTGCAAATACATTGTCCAGAACATGTAGCGGAGGGGACAACGCAGATCAACCCTTTGACATGACAAGAAACACTTTCGACAATT
TTTATTTTAATACATTGCAAAGGAAGTCAGGAGTTCTTTTCTCGGACCAGACACTGTACAACAGTCCAAGGACAAGAGGCATAGTGAATGCCTACGCCTTTAATCAAGCCATGTTCTTCC
TTGATTTCCAACAGGCAATGCTGAAAATGGGGTTGCTCGATGTTAAGGAAGGATCAAAAGGAGAAGTACGAGAATCTTGCCGCAAAATTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAATTATATTCTTGGTGTTTTTTTCTTCATGGAGATGATATTGAGTGGTTTTAGATTTGGGGCAGTGGATGGGCTGAGCATGAACTACTATCTTATGAGCTGCCCCTTTGCTGAT
CAAATAGTTAAGAACACAGTTACAAGAGCTCTGCAAGACGATCCTACTCTAGCTGCTGCCCTTGTTAGAATGCACTTCCATGACTGCTTTATACAA
GGATGTGATGGTTCTGTCCTCATT
GATTCAACAAAAGATAACACAGCAGAAAAGGATTCTCCAGCAAATCTAAGCTTACGAGGCTATGAAGTCATTGATGATGCAAAAGAGCAACTTGAAGAACAATGCCCAGGCGTCGTCTCA
TGTACTGACATTCTTGCAATAGCTGCTAGAGATGCAGTGTTCTGG
GCAGGGGGTCCATTTTATGAGATACCGAAAGGAAGAAAGGATGGAAGGAGGTCTAAGATAGAAGATACAATCAAC
TTGCCATTTCCCACCTCCAATGCCAGTGAGCTTATTAGGCAATTTGGGCAGCATGGTTTCACTGCTCAAGAAATGGTTGCCTTGTCTG
GAGCACACACGCTAGGAGTGGCAAGGTGCGCA
TCATTCAAGAACAGACTGACTAGTGCTGATCCAACAATGGATTCAGACTTTGCAAATACATTGTCCAGAACATGTAGCGGAGGGGACAACGCAGATCAACCCTTTGACATGACAAGAAAC
ACTTTCGACAATTTTTATTTTAATACATTGCAAAGGAAGTCAGGAGTTCTTTTCTCGGACCAGACACTGTACAACAGTCCAAGGACAAGAGGCATAGTGAATGCCTACGCCTTTAATCAA
GCCATGTTCTTCCTTGATTTCCAACAGGCAATGCTGAAAATGGGGTTGCTCGATGTTAAGGAAGGATCAAAAGGAGAAGTACGAGAATCTTGCCGCAAAATTAAT

Retrieve as FASTA