Entry information : RcPrx62 (30086.m000208)
Entry ID 9385
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx62 (30086.m000208)
Name (synonym) RcPrx62 (30086.m000208)
Class Class III peroxidase    [Orthogroup: Prx218]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx62
start..stop
S start..stop
RcPrx10 539 0 1..328 1..327
PtPrx28 536 0 1..328 1..327
MePrx106 534 0 1..328 1..328
PtPrx29 529 0 1..328 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 44897..45118 222 N° 2 45203..45391 189 N° 3 45510..45675 166 N° 4 45890..46302 413
join(44897..45118,45203..45391,45510..45675,45890..46302)


exon

Literature and cross-references RcPrx62 (30086.m000208)
DNA ref. Phytozome 12:   30086 (44897..46302)
Protein sequence: RcPrx62 (30086.m000208)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330
PWM (Da):   %s   36240.76 Transmb domain:   %s   i7-29o
PI (pH):   %s   9.07
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVQKLFRLLFAQLVLLLLFLDLTNAWGLYMRFYRRTCPRAEFIVHRTVYQYVSRDATLAAPLLRMHFHDCFVRGCDGSVLLQSTKNNQAEKDAIPNQTLRGFNVIDAIKSAIERECPGVVSCADILALAARDAVLMIGGPFWAVPTGRRDGRVSIASEALTQLPSPFANITELKQNFAAKGLNVKDLAVLSGGHTIGIGHCFIISNRLYNFTGRGDTDPSLDPIYAAQLKKKCKPGGSTKTIVEMDPGSFVSFDENYYTTVAKRRGLFQSDAALLDDFETSTYVRLQSLTGGLTFARDFSASMVKLGYVGILTGKQGEIRKHCGCVNK

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTGCAAAAGCTTTTTAGGCTTCTCTTTGCGCAACTGGTTCTCCTACTTCTGTTCTTAGATCTCACTAATGCATGGGGTTTATATATGAGGTTCTACAGGAGGACATGCCCTAGA
GCAGAGTTTATTGTCCATAGAACTGTTTACCAATACGTTTCTAGAGACGCAACTCTTGCTGCGCCTTTGTTGAGAATGCATTTCCATGATTGTTTCGTTAGG
GTAAGTTGTTCATTGTTA
CATAAACTTTCATGAGCTAGTAGTAATTATTTATGTAGAGCCTAACGAACGAGCTGTAATTGGCAGGGATGTGATGGTTCTGTGCTATTACAATCCACAAAGAATAATCAAGCTGAGAAA
GATGCAATCCCAAACCAAACCTTAAGAGGGTTCAATGTGATTGATGCTATAAAATCTGCTATAGAAAGGGAGTGTCCTGGAGTGGTTTCTTGTGCTGATATCTTGGCCTTAGCAGCTCGA
GATGCAGTTTTAATG
GTAAGTTTGTCCACTAATATCCTTGCACATATAAATGTTAAATATTAATTATAATCTGCCATCGTTCGTATTATTTTAAATTTATATCAAAACATTTTCTTTTTA
CCTGTCATTCCAGATTGGAGGACCATTCTGGGCAGTTCCTACTGGGCGCAGAGATGGAAGAGTGTCAATTGCTTCAGAGGCATTAACACAATTGCCATCTCCGTTCGCCAACATTACTGA
ACTTAAACAAAATTTTGCTGCTAAGGGTTTAAATGTTAAGGACCTTGCAGTTTTATCAG
GTGATAACTACAATATAATTATGTTATCTTTTTATTTGTAAACTCATAACAGAATGCGTAA
ATTCCATTAGAATTAAAGTGAAAGATCATAGTAAATTGGATGGTTTCTTATGCTATATAAAATTATTCCAAAAAAAAAAAATTAACAGGATATAACTGACTTCGTCTATCCTCTGTTTCA
TCTGATCAACTTGGAACTACTTTCTATTTGCAGGAGGGCACACAATTGGCATTGGACATTGCTTTATAATCTCAAACCGCTTATACAATTTCACCGGCAGAGGTGACACAGACCCATCAT
TGGACCCAATATACGCAGCTCAGTTGAAGAAAAAGTGCAAGCCAGGAGGAAGCACAAAGACTATCGTTGAAATGGACCCTGGAAGCTTCGTATCATTCGATGAAAATTACTATACTACTG
TAGCTAAAAGGAGAGGTCTTTTCCAATCCGATGCAGCTCTTCTTGATGACTTCGAAACCAGCACTTACGTCAGGCTTCAATCATTGACCGGTGGATTAACTTTTGCTCGAGATTTTTCTG
CATCAATGGTGAAATTAGGTTATGTCGGAATTCTTACTGGCAAGCAAGGCGAAATCAGAAAACATTGTGGTTGTGTCAACAAATGG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTGCAAAAGCTTTTTAGGCTTCTCTTTGCGCAACTGGTTCTCCTACTTCTGTTCTTAGATCTCACTAATGCATGGGGTTTATATATGAGGTTCTACAGGAGGACATGCCCTAGA
GCAGAGTTTATTGTCCATAGAACTGTTTACCAATACGTTTCTAGAGACGCAACTCTTGCTGCGCCTTTGTTGAGAATGCATTTCCATGATTGTTTCGTTAGG
GGATGTGATGGTTCTGTG
CTATTACAATCCACAAAGAATAATCAAGCTGAGAAAGATGCAATCCCAAACCAAACCTTAAGAGGGTTCAATGTGATTGATGCTATAAAATCTGCTATAGAAAGGGAGTGTCCTGGAGTG
GTTTCTTGTGCTGATATCTTGGCCTTAGCAGCTCGAGATGCAGTTTTAATG
ATTGGAGGACCATTCTGGGCAGTTCCTACTGGGCGCAGAGATGGAAGAGTGTCAATTGCTTCAGAGGCA
TTAACACAATTGCCATCTCCGTTCGCCAACATTACTGAACTTAAACAAAATTTTGCTGCTAAGGGTTTAAATGTTAAGGACCTTGCAGTTTTATCAG
GAGGGCACACAATTGGCATTGGA
CATTGCTTTATAATCTCAAACCGCTTATACAATTTCACCGGCAGAGGTGACACAGACCCATCATTGGACCCAATATACGCAGCTCAGTTGAAGAAAAAGTGCAAGCCAGGAGGAAGCACA
AAGACTATCGTTGAAATGGACCCTGGAAGCTTCGTATCATTCGATGAAAATTACTATACTACTGTAGCTAAAAGGAGAGGTCTTTTCCAATCCGATGCAGCTCTTCTTGATGACTTCGAA
ACCAGCACTTACGTCAGGCTTCAATCATTGACCGGTGGATTAACTTTTGCTCGAGATTTTTCTGCATCAATGGTGAAATTAGGTTATGTCGGAATTCTTACTGGCAAGCAAGGCGAAATC
AGAAAACATTGTGGTTGTGTCAACAAATGG

Retrieve as FASTA