Entry information : RcPrx68 (30147.m014371)
Entry ID 9390
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx68 (30147.m014371)
Name (synonym) RcPrx68 (30147.m014371)
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx68
start..stop
S start..stop
MePrx68 525 0 21..325 21..325
PtPrx88 511 0 3..325 1..323
LuPrx179 449 6e-160 2..326 1..326
LuPrx213 443 8e-158 2..326 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1565136..1565363 228 N° 2 1564577..1564756 180 N° 3 1564306..1564465 160 N° 4 1563788..1564203 416
complement(join(1563788..1564203,1564306..1564465,1564577..1564756,1565136..1565 363))


exon

Literature and cross-references RcPrx68 (30147.m014371)
DNA ref. Phytozome 12:   30147 (1565363..1563788)
Protein sequence: RcPrx68 (30147.m014371)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (305)
PWM (Da):   %s   35142.94 (32806.5) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.34 (5.10) Peptide Signal:   %s   cut: 24 range:24-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MIMIVKAALLILALGLFLGNLAGLCNGALQVGFYSGKCGFADVEAIVAGVVTPQFFKDPTIVAALLRLQFHDCFVNGCDASLLLDGRSSEKTAPPNLSVRGYDIIDQAKTAVERACPGVVSCADLIAIATRDVVFLSGGGRYNVQTGRRDGLISAGQNVSILGPKASVPEAVAAFAEIGLNTTDMVLLLGAHSVGVTHCSLIKDRLYDFEGSGNPDPLMDPFLVNLLRFRCPQFPAIDNTVNLDQNPFSPFFMDVSYYQNIMMHRGILQIDQELGMDPLTMPIVRNLAGEFDFPTRFGAAMVKLGTIGVLTDKQGEIRRSCRATNNE

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATAATGATAGTCAAGGCAGCACTTCTCATATTAGCTCTTGGGCTCTTTCTAGGAAACTTGGCAGGCTTGTGCAATGGTGCCCTGCAAGTAGGATTTTATAGTGGCAAATGTGGGTTT
GCGGATGTGGAGGCTATAGTTGCTGGTGTTGTCACTCCACAATTCTTTAAAGATCCTACTATTGTGGCTGCACTCCTACGTTTGCAGTTTCATGATTGCTTTGTTAAT
GTAAGCTTGCAT
TTCTGTCTGCTTTTTATTAAGAACATACAAGGTTAGTGGTAATTAATCAGAGGTAAACCATTAACTAAACATGGAATAATCCGTTCAAGATTTGTGCAGCAAGAAGCATGGAAGATTTGG
TAGTAAGCAAGCTTCGTGTGCACTTTTCCCAAAGTCTTAAGCTTATGCATTTTGTCTAATCTGATTAAATTTTTAAGAGGTTGGTAGCAGTTGTTAATACGCATGACCTCATTCTATGGC
ATTACTTACAATAACTAAATAAGAGTTGTATTCTCATTTCCCATGAGTTTACTATTAATTCTGCGATGCTTGGTGGAATTTTATTGAACTGACCAACTAATTGTCTGTGGCAATAATGAT
GGAATAGGGATGTGATGCATCACTACTTTTAGATGGACGTAGTAGCGAAAAAACAGCCCCACCAAATCTGAGCGTTAGGGGATATGATATCATAGATCAAGCAAAAACTGCGGTGGAGAG
AGCTTGCCCTGGTGTCGTCTCTTGTGCTGATCTCATTGCAATTGCTACAAGAGATGTTGTTTTCTTG
GTATCTATCTCTTTCTTTCCCTCTCATTGCAATAGCTGCTAGATAACCAAAAC
TCTGTCACATACCTTCACACTGCAACTGTAAGACTAATGAATACGCATAAAAATACAGAGTGGTGGAGGAAGGTATAATGTTCAAACAGGAAGAAGGGATGGTTTAATTTCTGCGGGTCA
AAATGTGAGTATCCTAGGACCTAAGGCTTCAGTGCCTGAAGCTGTTGCAGCTTTTGCTGAAATAGGACTCAATACCACAGACATGGTACTTCTTCTAG
GTACTCAAAAAGAACTTCCCTG
TTCATACTAATTTAATTTTGGTTCAGAACTTGACAAATTACTAACTCTAGAAAGAACCCTTTTTGCAATTTGTGGTATAGGTGCTCATTCAGTTGGAGTTACTCATTGTTCCCTAATCAA
AGACCGTCTCTACGATTTTGAAGGCAGTGGAAATCCTGATCCACTCATGGATCCTTTCCTAGTTAATCTATTGAGATTTAGATGTCCTCAGTTTCCTGCAATAGACAACACAGTCAACCT
TGATCAGAATCCATTCAGTCCATTCTTTATGGATGTGTCATACTATCAGAATATAATGATGCACAGAGGCATTCTCCAAATAGATCAAGAGCTTGGAATGGATCCATTGACTATGCCCAT
TGTCAGAAATTTAGCTGGTGAATTTGATTTCCCGACAAGGTTTGGTGCTGCCATGGTTAAATTGGGTACTATTGGAGTTCTTACTGATAAACAAGGAGAGATTAGGAGATCGTGTAGAGC
TACTAATAATGAAACC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATAATGATAGTCAAGGCAGCACTTCTCATATTAGCTCTTGGGCTCTTTCTAGGAAACTTGGCAGGCTTGTGCAATGGTGCCCTGCAAGTAGGATTTTATAGTGGCAAATGTGGGTTT
GCGGATGTGGAGGCTATAGTTGCTGGTGTTGTCACTCCACAATTCTTTAAAGATCCTACTATTGTGGCTGCACTCCTACGTTTGCAGTTTCATGATTGCTTTGTTAAT
GGATGTGATGCA
TCACTACTTTTAGATGGACGTAGTAGCGAAAAAACAGCCCCACCAAATCTGAGCGTTAGGGGATATGATATCATAGATCAAGCAAAAACTGCGGTGGAGAGAGCTTGCCCTGGTGTCGTC
TCTTGTGCTGATCTCATTGCAATTGCTACAAGAGATGTTGTTTTCTTG
AGTGGTGGAGGAAGGTATAATGTTCAAACAGGAAGAAGGGATGGTTTAATTTCTGCGGGTCAAAATGTGAGT
ATCCTAGGACCTAAGGCTTCAGTGCCTGAAGCTGTTGCAGCTTTTGCTGAAATAGGACTCAATACCACAGACATGGTACTTCTTCTAG
GTGCTCATTCAGTTGGAGTTACTCATTGTTCC
CTAATCAAAGACCGTCTCTACGATTTTGAAGGCAGTGGAAATCCTGATCCACTCATGGATCCTTTCCTAGTTAATCTATTGAGATTTAGATGTCCTCAGTTTCCTGCAATAGACAACACA
GTCAACCTTGATCAGAATCCATTCAGTCCATTCTTTATGGATGTGTCATACTATCAGAATATAATGATGCACAGAGGCATTCTCCAAATAGATCAAGAGCTTGGAATGGATCCATTGACT
ATGCCCATTGTCAGAAATTTAGCTGGTGAATTTGATTTCCCGACAAGGTTTGGTGCTGCCATGGTTAAATTGGGTACTATTGGAGTTCTTACTGATAAACAAGGAGAGATTAGGAGATCG
TGTAGAGCTACTAATAATGAAACC

Retrieve as FASTA