Entry information : RcPrx73 (30170.m014095)
Entry ID 9395
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-07 (Qiang Li)
Peroxidase information: RcPrx73 (30170.m014095)
Name (synonym) RcPrx73 (30170.m014095)
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx73
start..stop
S start..stop
MePrx77 564 0 1..344 1..346
MaPrx01 549 0 14..340 2..322
VvPrx89 548 0 1..344 1..352
CpapPrx09 542 0 6..344 2..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2814741..2815005 265 N° 2 2814401..2814592 192 N° 3 2814144..2814308 165 N° 4 2813661..2814070 410
complement(join(2813661..2814070,2814144..2814308,2814401..2814592,2814741..2815 005))


exon

Literature and cross-references RcPrx73 (30170.m014095)
DNA ref. Phytozome 12:   30170 (2815005..2813661)
Protein sequence: RcPrx73 (30170.m014095)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344 (320)
PWM (Da):   %s   37048.89 (34514.5) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.2 (7.98) Peptide Signal:   %s   cut: 25 range:25-344
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALSKTFFGFFIVIVLSSSTSSLAHPGLGWGGNGPFGGVSFGLFPEFYQFSCPQANDIVMSVLKKAVAEESRIAASLLRLHFHDCFVQGCDASVLLDDSATIVSEKNSGPNKNSLRGFEVIDEIKAKLEEACPQTVSCADILALAARGSIVLSGGPSWELPLGRRDSKTASLSGSNTLIPAPNSTIQNLITFFKRQGLNEVDLVALSGGHTIGVARCVTFKQRLYDQNGNNQPDETLEKTYYLGLKSVCPRSGGDNNISPLDFGSPIKFDNTYFKLLLWGKGLLTSDEALFAGKIGKTMKLVKNYAQDEALFFDQFAKSMIKMGNINPLTGSSGQVRNNCRRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACTCTCGAAAACTTTCTTTGGTTTTTTCATAGTGATTGTCCTATCATCATCTACAAGCTCCCTAGCTCATCCTGGTCTTGGCTGGGGTGGTAATGGCCCTTTTGGTGGTGTCTCA
TTTGGTTTGTTTCCTGAGTTTTATCAGTTTTCATGCCCTCAAGCCAATGACATAGTCATGTCTGTTCTGAAAAAGGCCGTTGCCGAGGAATCCAGGATCGCTGCCTCTTTGCTAAGGCTT
CATTTCCATGATTGCTTTGTGCAGG
TTTTACACACTATTAGTAACTCTTCACTAAGAGGCTAAGCTAAGATCATTGCTTTTTAAACGATGGAAAGAATTGCACAGTTCTTGTATTTTATC
CTTACTTGATGCGTATTGATTAAAAGAAGCAAAAGTGTTGTTATTCTTACAGGGCTGCGATGCGTCAGTACTGTTGGATGATAGCGCCACAATAGTGAGTGAAAAGAATTCTGGACCAAA
CAAGAACTCCCTGAGAGGATTTGAAGTGATTGATGAGATCAAGGCCAAGTTAGAAGAAGCATGTCCTCAGACTGTCTCTTGTGCTGATATCCTCGCCTTGGCAGCTCGTGGGTCAATCGT
ACTAG
TAAGCAAAAACAACCTCATATTGAACTACATTCACTTACTTCTAATGCTTTACATATTTAACGCTAACAAAGGTCATTGGTGTTAACTCAGAGCGGCGGACCCAGTTGGGAGCTC
CCACTTGGAAGAAGGGACTCGAAGACTGCAAGTCTCAGTGGCTCAAACACACTTATTCCAGCACCAAACTCCACTATCCAAAACCTCATAACCTTTTTCAAGCGTCAAGGCCTTAATGAG
GTTGACCTTGTCGCACTCTCAG
GTAAGAATTTATCTTCTTGCTGTATTTGAATTTACATCTGATATAAGACCCATTTAAACATGCTTAATTGCAGGGGGGCATACAATTGGGGTAGCAAG
GTGCGTGACATTCAAGCAGAGGCTATACGACCAAAATGGAAACAACCAACCAGATGAGACACTGGAGAAAACATACTACCTAGGATTGAAGTCAGTGTGTCCAAGATCAGGTGGTGACAA
TAACATCTCTCCATTGGATTTTGGGTCCCCAATAAAATTTGATAACACTTACTTCAAGCTTCTTCTTTGGGGCAAGGGACTTCTCACTTCAGATGAAGCTCTTTTCGCAGGAAAAATTGG
CAAGACTATGAAATTAGTCAAGAATTATGCACAGGATGAGGCACTTTTCTTTGACCAATTTGCCAAGTCAATGATTAAGATGGGCAACATTAATCCTCTTACTGGTTCTAGTGGCCAAGT
CAGGAACAATTGCCGTCGTGTTAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACTCTCGAAAACTTTCTTTGGTTTTTTCATAGTGATTGTCCTATCATCATCTACAAGCTCCCTAGCTCATCCTGGTCTTGGCTGGGGTGGTAATGGCCCTTTTGGTGGTGTCTCA
TTTGGTTTGTTTCCTGAGTTTTATCAGTTTTCATGCCCTCAAGCCAATGACATAGTCATGTCTGTTCTGAAAAAGGCCGTTGCCGAGGAATCCAGGATCGCTGCCTCTTTGCTAAGGCTT
CATTTCCATGATTGCTTTGTGCAGG
GCTGCGATGCGTCAGTACTGTTGGATGATAGCGCCACAATAGTGAGTGAAAAGAATTCTGGACCAAACAAGAACTCCCTGAGAGGATTTGAAGTG
ATTGATGAGATCAAGGCCAAGTTAGAAGAAGCATGTCCTCAGACTGTCTCTTGTGCTGATATCCTCGCCTTGGCAGCTCGTGGGTCAATCGTACTAG
GCGGCGGACCCAGTTGGGAGCTC
CCACTTGGAAGAAGGGACTCGAAGACTGCAAGTCTCAGTGGCTCAAACACACTTATTCCAGCACCAAACTCCACTATCCAAAACCTCATAACCTTTTTCAAGCGTCAAGGCCTTAATGAG
GTTGACCTTGTCGCACTCTCAG
GGGGGCATACAATTGGGGTAGCAAGGTGCGTGACATTCAAGCAGAGGCTATACGACCAAAATGGAAACAACCAACCAGATGAGACACTGGAGAAAACA
TACTACCTAGGATTGAAGTCAGTGTGTCCAAGATCAGGTGGTGACAATAACATCTCTCCATTGGATTTTGGGTCCCCAATAAAATTTGATAACACTTACTTCAAGCTTCTTCTTTGGGGC
AAGGGACTTCTCACTTCAGATGAAGCTCTTTTCGCAGGAAAAATTGGCAAGACTATGAAATTAGTCAAGAATTATGCACAGGATGAGGCACTTTTCTTTGACCAATTTGCCAAGTCAATG
ATTAAGATGGGCAACATTAATCCTCTTACTGGTTCTAGTGGCCAAGTCAGGAACAATTGCCGTCGTGTTAAC

Retrieve as FASTA