Entry information : RcPrx75 (30174.m009155)
Entry ID 9397
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx75 (30174.m009155)
Name (synonym) RcPrx75 (30174.m009155)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx75
start..stop
S start..stop
MePrx32 540 0 7..328 2..321
RcPrx54 527 0 9..328 4..324
MePrx134 518 0 5..328 9..331
MePrx31 513 0 11..328 5..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3330951..3331358 408 N° 2 3331554..3331716 163 N° 3 3331862..3332274 413  
join(3330951..3331358,3331554..3331716,3331862..3332274)


exon

Literature and cross-references RcPrx75 (30174.m009155)
DNA ref. Phytozome 12:   30174 (3330951..3332274)
Protein sequence: RcPrx75 (30174.m009155)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (300)
PWM (Da):   %s   35078.88 (31949.3) Transmb domain:   %s   i7-26o
PI (pH):   %s   8.94 (8.58) Peptide Signal:   %s   cut: 29 range:29-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MERYSSGQRFIVIMLFLAAMSATTLVRGQGTRVGFYSITCPNAESIIRSTVQTHFKTDPAIAPGLLRMHFHDCFVRGCDASILINGSNTEKTALPNLGLRGHEVIDDAKTQLEAACPGTVSCADILALAARDSVALTSGGSWLVPTGRRDGRVSLASEASALPGFTESIDSQKQKFAAKGLNTQDLVTLVGGHTIGTTACQFFNYRLYNTTGNGSDPSISASFLPQLQALCPQIGDGKKRVALDTNSSNKFDTSFFINLKNGRGILESDQKLWTDASTRPFVQRFLGVRGLAALNFNVEFGKSMIKMSNIGVKTGTDGEIRKICSAV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGGTATTCTTCAGGCCAAAGATTCATTGTAATTATGTTGTTCTTGGCAGCCATGTCTGCCACCACTTTGGTGCGAGGCCAAGGCACCCGTGTTGGATTCTATTCTATCACTTGT
CCTAATGCTGAATCTATTATACGCTCCACAGTTCAAACCCATTTTAAGACTGACCCTGCAATTGCTCCTGGTTTGCTTAGGATGCATTTCCATGATTGTTTTGTTCGAGGCTGTGATGCT
TCTATCCTTATCAACGGCTCCAATACAGAGAAAACAGCCCTACCGAATCTTGGGTTGAGAGGACATGAAGTTATTGACGATGCCAAGACTCAGCTTGAAGCTGCATGCCCTGGAACTGTT
TCTTGCGCTGATATTCTTGCACTTGCTGCCCGTGATTCTGTTGCTCTG
GTAATTATCTTACTACCAATGAGTTTTGGCTTAGTGATGCCGGTGTAGACTAAAATAGTGAAGTTACAAGTT
AATTTGTAACATTAAATAATTAATTATGCTATATATATTGTTTGTGTACATACCTATATATATATATATACACACTTTAGCAGTACTATTGTGTAAGCATGCTTCGTTTTGAACCACATG
CAGACTAGTGGAGGAAGTTGGCTGGTGCCTACTGGACGTAGAGATGGCCGAGTGTCATTAGCATCTGAAGCTAGTGCTTTGCCTGGCTTCACTGAATCTATTGATTCACAAAAGCAAAAA
TTTGCTGCAAAGGGTCTTAACACACAAGATCTTGTTACACTTGTTG
GTGAGTACTGTTAATAATTAAATTCGAATTTGAATCCCCTGATGGTAAAAACCTACATGCATGACTGATCATAT
TTCTTTTCAAGAAGATAGCATATTAACATGTTTACTAACTTCCATACATATGCTTTTGGACTTTTTGCCAGGAGGACACACCATTGGAACTACAGCTTGCCAATTCTTCAATTACAGATT
ATATAATACAACTGGAAATGGGTCTGATCCTTCCATTAGTGCTTCATTTCTGCCTCAACTACAAGCACTATGTCCACAAATTGGTGACGGGAAAAAGAGGGTTGCACTAGACACAAATAG
TTCAAACAAGTTCGACACATCTTTCTTCATTAACTTAAAGAATGGCAGAGGAATACTTGAGTCCGACCAAAAACTGTGGACAGACGCTTCTACAAGACCCTTTGTACAACGTTTCTTGGG
TGTTAGAGGCTTGGCTGCATTAAACTTCAACGTCGAGTTTGGGAAGTCCATGATCAAGATGAGTAATATAGGAGTGAAGACTGGCACTGATGGTGAAATTCGAAAAATATGTTCTGCAGT
AAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGGTATTCTTCAGGCCAAAGATTCATTGTAATTATGTTGTTCTTGGCAGCCATGTCTGCCACCACTTTGGTGCGAGGCCAAGGCACCCGTGTTGGATTCTATTCTATCACTTGT
CCTAATGCTGAATCTATTATACGCTCCACAGTTCAAACCCATTTTAAGACTGACCCTGCAATTGCTCCTGGTTTGCTTAGGATGCATTTCCATGATTGTTTTGTTCGAGGCTGTGATGCT
TCTATCCTTATCAACGGCTCCAATACAGAGAAAACAGCCCTACCGAATCTTGGGTTGAGAGGACATGAAGTTATTGACGATGCCAAGACTCAGCTTGAAGCTGCATGCCCTGGAACTGTT
TCTTGCGCTGATATTCTTGCACTTGCTGCCCGTGATTCTGTTGCTCTG
ACTAGTGGAGGAAGTTGGCTGGTGCCTACTGGACGTAGAGATGGCCGAGTGTCATTAGCATCTGAAGCTAGT
GCTTTGCCTGGCTTCACTGAATCTATTGATTCACAAAAGCAAAAATTTGCTGCAAAGGGTCTTAACACACAAGATCTTGTTACACTTGTTG
GAGGACACACCATTGGAACTACAGCTTGC
CAATTCTTCAATTACAGATTATATAATACAACTGGAAATGGGTCTGATCCTTCCATTAGTGCTTCATTTCTGCCTCAACTACAAGCACTATGTCCACAAATTGGTGACGGGAAAAAGAGG
GTTGCACTAGACACAAATAGTTCAAACAAGTTCGACACATCTTTCTTCATTAACTTAAAGAATGGCAGAGGAATACTTGAGTCCGACCAAAAACTGTGGACAGACGCTTCTACAAGACCC
TTTGTACAACGTTTCTTGGGTGTTAGAGGCTTGGCTGCATTAAACTTCAACGTCGAGTTTGGGAAGTCCATGATCAAGATGAGTAATATAGGAGTGAAGACTGGCACTGATGGTGAAATT
CGAAAAATATGTTCTGCAGTAAAC

Retrieve as FASTA