Entry information : VvPrx85 (GSVIVT01036100001)
Entry ID 9416
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: VvPrx85 (GSVIVT01036100001)
Name (synonym) VvPrx85 (GSVIVT01036100001)
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Vitaceae Vitis
Organism Vitis vinifera (Grape)    [TaxId: 29760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value VvPrx85
start..stop
S start..stop
EcamPrx62 410 7e-145 4..332 6..325
EguPrx63 410 2e-144 15..332 18..325
EguPrx62 410 2e-144 4..332 6..325
EgrPrx63 407 3e-143 23..332 26..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20717085..20717303 219 N° 2 20717411..20717590 180 N° 3 20717811..20717970 160 N° 4 20718075..20718517 443
join(20717085..20717303,20717411..20717590,20717811..20717970,20718075..20718517 )


exon

Literature and cross-references VvPrx85 (GSVIVT01036100001)
DNA ref. Phytozome 12:   chr6 (20717085..20718517)
Protein sequence: VvPrx85 (GSVIVT01036100001)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (308)
PWM (Da):   %s   35799.11 (33121.8)  
PI (pH):   %s   7.38 (6.98) Peptide Signal:   %s   cut: 26 range:26-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKMSAAAVALAFALVLANFANQCHGALQEGFYKGKCNVDVEKIVSGIITPLVGQKPWITPALLRMQFHDCFVKGCDASILLDGSSSEKTAPPNLSVRGYDVIDLVKAAIEKMCPGVVSCADVIVMATRDAVAASKGGWYSVQTGRRDGLVSLATNVNLPGPSVSVENSTAIFNSKGISTEDMVYLLGGHTVGVTHCSLFKDRLYNFNNTGRPDPTMQPSLAFFLRLRCPQSSTVDNTVNLDQGGSSADLLGEPTSNTVDNSFYKQIVFHRGVLQIDQALALHQLTKDTVNTVAFAPNDYFLTKFQQAMVKLGAVEVLTDAQGEIRKSCRATNF*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Extra sequence at 5' end has been deleted).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATGTCTGCAGCAGCAGTTGCTCTCGCTTTCGCCCTTGTTCTTGCAAACTTCGCCAACCAGTGCCATGGCGCACTGCAGGAGGGATTCTACAAGGGAAAATGTAACGTAGATGTT
GAGAAGATAGTGTCCGGTATCATCACCCCACTAGTTGGTCAGAAACCGTGGATCACACCAGCTCTCTTGCGCATGCAGTTTCATGATTGCTTTGTCAAG
GTTAACTCTTATCTTCTGATA
TGTATAATTAGTAGATTCCATGCCAATGATATTAGAAAGAAAACCATCAAATCTTCGAGCTAACATGTAATGTTTTCTATGAAAAGGGATGTGATGCATCAATCCTACTAGATGGGAGCT
CGAGCGAGAAAACTGCACCACCGAACCTAAGCGTGAGGGGATACGATGTTATCGATTTAGTCAAGGCTGCTATTGAGAAAATGTGCCCTGGAGTGGTATCTTGTGCTGATGTCATTGTCA
TGGCAACGAGAGATGCTGTTGCTGCG
GTAAATAATATTCCCATTTTTTGTCAAATACATTGAATTGGATAATCTTTTAGTATTGATCTATACATTAGGAGGGTTTGGTATGACCACAACA
ATTTAAATAGAAGCAATTTATGTTTCATAAATCATTTCCAAGGAATGTTCATAAAATGGGGTTTAGTTTATCAAATACTAATACTGACTGTTTTGAGCTTATGGTAATACGTGTGTGATC
ATGCAGAGTAAAGGAGGGTGGTACAGTGTTCAAACAGGTAGAAGAGATGGCTTGGTATCTCTGGCTACAAATGTGAATCTCCCTGGTCCTTCAGTCTCAGTGGAGAATTCCACTGCAATA
TTCAACAGCAAAGGAATTAGCACTGAAGACATGGTTTACCTTCTTG
GTATAGTTTACATTTACCTCCCCTAGTTTTTTCTTTACTTTTAAGTGCATTAAACTGATCATGGAAGATGCCAA
CTGATGGATTGATTTTGCTTCTTGATATAGGTGGTCACACTGTTGGAGTGACGCATTGTTCCCTCTTCAAAGATCGTTTGTACAATTTCAATAACACTGGGAGACCTGATCCAACCATGC
AACCTTCGCTAGCTTTCTTCCTCAGATTAAGATGCCCTCAGAGTTCAACAGTTGACAACACAGTCAATCTTGACCAAGGTGGAAGCTCAGCAGATCTACTAGGCGAACCGACTTCAAACA
CCGTCGACAATTCCTTCTACAAGCAAATAGTGTTCCATAGAGGAGTTCTTCAAATTGATCAAGCACTGGCGTTGCATCAGCTGACCAAAGACACAGTGAACACAGTAGCCTTTGCACCAA
ATGACTACTTCCTTACCAAGTTTCAACAGGCCATGGTTAAGCTGGGTGCGGTTGAAGTCCTCACTGATGCTCAAGGAGAAATAAGGAAATCATGCCGAGCCACTAATTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATGTCTGCAGCAGCAGTTGCTCTCGCTTTCGCCCTTGTTCTTGCAAACTTCGCCAACCAGTGCCATGGCGCACTGCAGGAGGGATTCTACAAGGGAAAATGTAACGTAGATGTT
GAGAAGATAGTGTCCGGTATCATCACCCCACTAGTTGGTCAGAAACCGTGGATCACACCAGCTCTCTTGCGCATGCAGTTTCATGATTGCTTTGTCAAG
GGATGTGATGCATCAATCCTA
CTAGATGGGAGCTCGAGCGAGAAAACTGCACCACCGAACCTAAGCGTGAGGGGATACGATGTTATCGATTTAGTCAAGGCTGCTATTGAGAAAATGTGCCCTGGAGTGGTATCTTGTGCT
GATGTCATTGTCATGGCAACGAGAGATGCTGTTGCTGCG
AGTAAAGGAGGGTGGTACAGTGTTCAAACAGGTAGAAGAGATGGCTTGGTATCTCTGGCTACAAATGTGAATCTCCCTGGT
CCTTCAGTCTCAGTGGAGAATTCCACTGCAATATTCAACAGCAAAGGAATTAGCACTGAAGACATGGTTTACCTTCTTG
GTGGTCACACTGTTGGAGTGACGCATTGTTCCCTCTTCAAA
GATCGTTTGTACAATTTCAATAACACTGGGAGACCTGATCCAACCATGCAACCTTCGCTAGCTTTCTTCCTCAGATTAAGATGCCCTCAGAGTTCAACAGTTGACAACACAGTCAATCTT
GACCAAGGTGGAAGCTCAGCAGATCTACTAGGCGAACCGACTTCAAACACCGTCGACAATTCCTTCTACAAGCAAATAGTGTTCCATAGAGGAGTTCTTCAAATTGATCAAGCACTGGCG
TTGCATCAGCTGACCAAAGACACAGTGAACACAGTAGCCTTTGCACCAAATGACTACTTCCTTACCAAGTTTCAACAGGCCATGGTTAAGCTGGGTGCGGTTGAAGTCCTCACTGATGCT
CAAGGAGAAATAAGGAAATCATGCCGAGCCACTAATTTTTAA

Retrieve as FASTA