Entry information : VvPrx88 ( GSVIVT01009108001)
Entry ID 9419
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2016-01-17 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-17 (Achraf Jemmat)
Peroxidase information: VvPrx88 ( GSVIVT01009108001)
Name (synonym) VvPrx88 ( GSVIVT01009108001)
Class Class III peroxidase    [Orthogroup: Prx160]
Taxonomy Eukaryota Viridiplantae Streptophyta Vitaceae Vitis
Organism Vitis vinifera (Grape)    [TaxId: 29760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value VvPrx88
start..stop
S start..stop
VvPrx49 592 0 1..315 1..315
VvPrx21 567 0 1..316 1..316
VvPrx07 517 0 1..315 1..316
VvPrx35 487 2e-175 10..315 19..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..207 207 N° 2 476..667 192 N° 3 1025..1190 166 N° 4 1392..1777 386
join(1..207,476..667,1025..1190,1392..1777)


exon

Literature and cross-references VvPrx88 ( GSVIVT01009108001)
DNA ref. Phytozome 12:   chr18 (5107201..5108978)
Protein sequence: VvPrx88 ( GSVIVT01009108001)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (294)
PWM (Da):   %s   33740.11 (31278.0)  
PI (pH):   %s   4.31 (4.25) Peptide Signal:   %s   cut: 23 range:23-316
Sequence 358
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLSLFSLFCMFSFLLGMAHAQLSSDYYSSSCPSALSTIQTAVNNAVADESRMGASLLRLHFHDCFVLGCDASILLDDTANFTGEKTAGPNNNSVRGYDVIDTIKSQMESLCPGVVSCADIVAVAARDSVVALGGPTWTVQLGRRDSTTASFSTANSDLPAPTSDLDALISLFSNKGFTTQEMVVLSGTHTIGKAQCSKFRDRIYNETNIDATFATSKQAICPSSGGDENLSDLDETTTVFDNVYFTNLIEKKGLLHSDQQLYNGNSTDSMVETYSNDSTTFFTDVASAMVKMGNLSPLTGTDGEIRTNCRAING*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 18, 3 introns). Incorrect prediction from phytozome (splicing error and extra exons in 3').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTCCCTCTCCTTGTTTTCCTTATTCTGTATGTTTTCGTTTCTATTGGGGATGGCACATGCACAGCTATCTTCCGACTACTACTCAAGTTCATGCCCTAGCGCTCTGTCTACCATTC
AAACTGCAGTAAACAATGCAGTGGCTGACGAGTCCCGCATGGGGGCCTCACTGCTCCGCCTTCATTTCCATGATTGCTTTGTATTG
GCAAGTCTTTCTCCACATATATTTAGCTCCATTT
TTCTGGATATTCTGTTTTTTACTACTTGTTCTGGTTGCTTCTGACCAGCTCTCCAATTTAGGTTTGAAATCCAGAAGTCAACCGGATCATTTGGTACTGGTTGAGCTTTAAGATGTTAAT
AAACCTCAGTCAATCCCTTCATAAAGAGAAAAATATTAGTAACATGCATGCACACATACAGCTGTTTGACAGGAAAATGCGTACTAACAACATCTTCATGTATAAATTCAACAGGGATGT
GATGCTTCTATATTATTGGATGACACTGCAAACTTTACTGGAGAGAAGACAGCAGGACCAAATAATAACTCTGTGAGAGGATATGATGTGATCGACACCATTAAATCTCAAATGGAAAGC
TTGTGCCCTGGAGTTGTTTCTTGTGCAGATATTGTAGCTGTGGCAGCTCGTGACTCTGTTGTTGCT
GTAAGAGACCAACTTCCTTCGCAACTACTACGTATATAATCATTAATCATAACC
TTGCAGTTTATAATGGGGTTCAGAAATATAATAATCTGTCTTTCGTATTCTCCAAACACAATTATTTTAGAGTATTTCTGGCCAGGCTTCATTAACCATCACAGAACCCTCATCATGGCC
AAACTTTTAATTAACATGGGTGCACGCTAAAACATGGCTCCGTATACCGTTGTCCTGCTGAATTACGATAAAACTCATCCCAAAAAATCTTGATGGTTCTATTAAAGATTAATAGGCTAA
GACACTTCAAATAATTAGTTCATTAACTAAATATTGTTGTTGATTGATTATGGGTTTTTTCAGTTGGGTGGCCCAACATGGACTGTGCAATTGGGCAGAAGAGATTCAACCACGGCGAGT
TTTAGTACTGCTAACTCTGACCTCCCTGCTCCGACCTCAGATCTTGATGCTCTTATATCTCTCTTCTCCAACAAGGGCTTCACTACCCAGGAAATGGTGGTTCTCTCAG
GTATACTATGG
CATTTGGTAGCACAAATAATTAGAAATTTGATAAAAATAGTTTTTTTTTTTAATATAAAAAAATGATATCGTACTTCAAGAGTGGTTTTCATTTCCGTTGCCAAATGGGCCCTATATATA
TCACCATTGTATTTATTATGGAAAATTCCTCATAATTTGTTATATGTGTGGGTTTTTTTTTATCTTTCAGGAACTCATACCATAGGCAAAGCACAATGCTCAAAATTTCGGGATCGAATT
TACAACGAGACCAACATCGATGCAACATTTGCAACATCAAAACAGGCAATCTGCCCAAGCTCAGGTGGAGATGAGAATCTGTCTGATCTGGATGAAACGACTACTGTTTTCGATAATGTT
TATTTCACGAATTTGATAGAGAAGAAGGGTCTGTTGCACTCAGACCAACAACTCTACAATGGTAACTCCACAGATTCCATGGTTGAAACCTACAGCAACGACTCTACCACTTTCTTTACC
GATGTGGCCAGCGCCATGGTTAAAATGGGAAACTTGAGTCCCCTAACCGGTACTGACGGAGAGATCAGGACAAACTGCAGGGCAATAAACGGATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTCCCTCTCCTTGTTTTCCTTATTCTGTATGTTTTCGTTTCTATTGGGGATGGCACATGCACAGCTATCTTCCGACTACTACTCAAGTTCATGCCCTAGCGCTCTGTCTACCATTC
AAACTGCAGTAAACAATGCAGTGGCTGACGAGTCCCGCATGGGGGCCTCACTGCTCCGCCTTCATTTCCATGATTGCTTTGTATTG
GGATGTGATGCTTCTATATTATTGGATGACACTG
CAAACTTTACTGGAGAGAAGACAGCAGGACCAAATAATAACTCTGTGAGAGGATATGATGTGATCGACACCATTAAATCTCAAATGGAAAGCTTGTGCCCTGGAGTTGTTTCTTGTGCAG
ATATTGTAGCTGTGGCAGCTCGTGACTCTGTTGTTGCT
TTGGGTGGCCCAACATGGACTGTGCAATTGGGCAGAAGAGATTCAACCACGGCGAGTTTTAGTACTGCTAACTCTGACCTCC
CTGCTCCGACCTCAGATCTTGATGCTCTTATATCTCTCTTCTCCAACAAGGGCTTCACTACCCAGGAAATGGTGGTTCTCTCAG
GAACTCATACCATAGGCAAAGCACAATGCTCAAAAT
TTCGGGATCGAATTTACAACGAGACCAACATCGATGCAACATTTGCAACATCAAAACAGGCAATCTGCCCAAGCTCAGGTGGAGATGAGAATCTGTCTGATCTGGATGAAACGACTACTG
TTTTCGATAATGTTTATTTCACGAATTTGATAGAGAAGAAGGGTCTGTTGCACTCAGACCAACAACTCTACAATGGTAACTCCACAGATTCCATGGTTGAAACCTACAGCAACGACTCTA
CCACTTTCTTTACCGATGTGGCCAGCGCCATGGTTAAAATGGGAAACTTGAGTCCCCTAACCGGTACTGACGGAGAGATCAGGACAAACTGCAGGGCAATAAACGGATAA

Retrieve as FASTA