Entry information : VvPrx96 (GSVIVT01029771001)
Entry ID 9427
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status partial
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: VvPrx96 (GSVIVT01029771001)
Name (synonym) VvPrx96 (GSVIVT01029771001)
Class Class III peroxidase     [Orthogroup: Prx005]*
Taxonomy Eukaryota Viridiplantae Streptophyta Vitaceae Vitis
Organism Vitis vinifera (Grape)    [TaxId: 29760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value VvPrx96
start..stop
S start..stop
VvPrx41 461 1e-165 2..298 6..305
VvPrx52 459 7e-165 14..298 19..305
VvPrx40 455 3e-163 10..298 2..292
VvPrx97 446 1e-159 14..298 19..305
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14449266..14449637 372 N° 2 14449026..14449188 163 N° 3 14448034..14448395 362  
complement(join(14448034..14448395,14449026..14449188,14449266..14449637))


exon

Literature and cross-references VvPrx96 (GSVIVT01029771001)
DNA ref. Phytozome 12:   chr12 (14449637..14448034)
Protein sequence: VvPrx96 (GSVIVT01029771001)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   298 (282)
PWM (Da):   %s   32301.15 (30543.2)  
PI (pH):   %s   8.32 (8.14) Peptide Signal:   %s   cut: 17 range:17-298
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFVFLLLAKAFALVHGQGTRVGFYSASCPQAEFIVQLTVAAHFQSDPAIARGLLRMHFHDCFVRGCDASILINGTSTEKTTTPNSLLKGYDAIDDAKSQIEDVCPGVVSCADILALAARDAVVLTNGPRWLVLTERRDGRVSLASDTNNLPGFTESIASQKKKFADKGFNDQDLVTLVGGHTIGTAACQSFRYRLYNCSNTSANGGDPCMDAAFVSQLQKMCPANRDGSKRIALDTGSSDRFGGSFFTNLRNGRGILESDWKLRTDASTRAYVQRFLGLRGELNFNMEFGRSIVKMSN

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from phytozome (Very short 3' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTGTGTTTCTCTTGCTTGCCAAAGCCTTTGCATTGGTGCATGGCCAAGGCACAAGGGTTGGTTTCTATTCAGCTTCATGCCCTCAAGCTGAATTCATTGTTCAGCTAACTGTTGCA
GCTCATTTCCAATCTGATCCAGCCATTGCCCGTGGCCTGCTTCGCATGCACTTTCATGACTGTTTTGTCAGGGGCTGTGATGCTTCTATCCTTATCAATGGAACGTCCACCGAGAAAACA
ACCACTCCAAACAGTCTTTTAAAAGGATATGATGCTATTGATGATGCCAAATCCCAGATTGAAGACGTCTGCCCTGGGGTGGTCTCTTGCGCTGATATTCTTGCCCTGGCCGCCCGTGAT
GCTGTGGTTCTG
GTACTAATCAAGCATGTTTTTATCATATTGTATACAATATGTTCGAATATATATGATTTTTTGAATGTTACATGCAGACCAATGGACCACGCTGGCTAGTGCTAACGG
AACGAAGAGATGGGCGAGTTTCATTGGCATCCGACACTAACAATTTGCCAGGCTTCACTGAATCCATTGCCTCTCAAAAGAAAAAATTTGCAGACAAGGGTTTTAATGATCAAGATCTCG
TTACTCTTGTTG
GTAAAAGCATAAATATTAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGATAATGAACCAAAGTTAGAATTATTAGTACTGCTGCTTATTCTGTAACCTAATTCCATGTGTCT
GTTTGTGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGGACACACCATCGGAACTGCAGCATGCCAGTCCTTCAGATACAGATTATACAACTGCAGCAATACATCAGCAAATG
GTGGTGACCCTTGCATGGACGCCGCATTCGTTTCTCAACTACAAAAGATGTGTCCAGCCAACCGTGATGGGAGTAAGCGTATTGCACTAGACACAGGTAGCTCCGACAGATTCGGCGGAT
CTTTCTTTACAAACTTGAGGAATGGACGCGGAATACTGGAGTCGGATTGGAAGTTGCGGACAGATGCTTCCACAAGAGCTTATGTACAACGGTTCTTGGGGCTGAGAGGGGAGCTGAACT
TCAACATGGAGTTTGGGAGGTCCATAGTGAAGATGAGTAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTGTGTTTCTCTTGCTTGCCAAAGCCTTTGCATTGGTGCATGGCCAAGGCACAAGGGTTGGTTTCTATTCAGCTTCATGCCCTCAAGCTGAATTCATTGTTCAGCTAACTGTTGCA
GCTCATTTCCAATCTGATCCAGCCATTGCCCGTGGCCTGCTTCGCATGCACTTTCATGACTGTTTTGTCAGGGGCTGTGATGCTTCTATCCTTATCAATGGAACGTCCACCGAGAAAACA
ACCACTCCAAACAGTCTTTTAAAAGGATATGATGCTATTGATGATGCCAAATCCCAGATTGAAGACGTCTGCCCTGGGGTGGTCTCTTGCGCTGATATTCTTGCCCTGGCCGCCCGTGAT
GCTGTGGTTCTG
ACCAATGGACCACGCTGGCTAGTGCTAACGGAACGAAGAGATGGGCGAGTTTCATTGGCATCCGACACTAACAATTTGCCAGGCTTCACTGAATCCATTGCCTCTCAA
AAGAAAAAATTTGCAGACAAGGGTTTTAATGATCAAGATCTCGTTACTCTTGTTG
GAGGACACACCATCGGAACTGCAGCATGCCAGTCCTTCAGATACAGATTATACAACTGCAGCAAT
ACATCAGCAAATGGTGGTGACCCTTGCATGGACGCCGCATTCGTTTCTCAACTACAAAAGATGTGTCCAGCCAACCGTGATGGGAGTAAGCGTATTGCACTAGACACAGGTAGCTCCGAC
AGATTCGGCGGATCTTTCTTTACAAACTTGAGGAATGGACGCGGAATACTGGAGTCGGATTGGAAGTTGCGGACAGATGCTTCCACAAGAGCTTATGTACAACGGTTCTTGGGGCTGAGA
GGGGAGCTGAACTTCAACATGGAGTTTGGGAGGTCCATAGTGAAGATGAGTAATTAG

Retrieve as FASTA