Entry information : SiAPx04 (Si010467m)
Entry ID 9433
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiAPx04 (Si010467m)
Name (synonym) SiAPx04 (Si010467m)
Class Ascorbate peroxidase    [Orthogroup: APx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiAPx04
start..stop
S start..stop
SbAPx09 646 0 1..353 1..351
ZmAPx10 643 0 1..353 1..351
OsAPx10 570 0 1..353 1..348
BdiAPx08 535 0 1..353 11..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 29032159..29032260 102 N° 2 29032354..29032470 117 N° 3 29032602..29032686 85 N° 4 29032780..29032814 35
N° 5 29032908..29032973 66 N° 6 29033084..29033123 40 N° 7 29033262..29033387 126 N° 8 29033505..29033611 107
N° 9 29033741..29033878 138 N° 10 29033977..29034111 135 N° 11 29034215..29034325 111  
join(29032159..29032260,29032354..29032470,29032602..29032686,29032780..29032814 ,29032908..29032973,29033084..29033123,29033262..29033387,29033505..29033611,290 33741..29033878,29033977..29034111,29034215..29034325)


exon

Literature and cross-references SiAPx04 (Si010467m)
DNA ref. Phytozome 12:   scaffold_7 (29032159..29034325)
Protein sequence: SiAPx04 (Si010467m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   354 (334)
PWM (Da):   %s   38101.51 (36259.5)  
PI (pH):   %s   8.18 (7.34) Peptide Signal:   %s   cut: 20 range:20-353
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGAAFLSTALLGARGVAASSSSSVSSPARRHAHIQVCCKGNVEGLEAAGHDERLRFRRRDFIGSCVGTAIGLEMIEGSSKFTGEATAADLIERRQRSEFQSSIKDTLYTAIKAKPELVPSLLTLALNDAITYDKATKTGGANGSIRLEISRPENSGLSAALDLLTEAKKEIDSNSKGGPISFADLIQFAAQSALKRSFLDAAIAKCGGNEDKGRTLYSAYGSNGQWGLFDRTFGRTDAQDADPEGRVPDWSKASVQEMKDRFVAVGLGPRQLAVMSAFLGPDQAATEERLIADPDCRPWVEKYQRSRETVSRTDYEVDLITALTKLGSLGQKINYEAYTYPKQKIDLGKLKL*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGGGGCGGCCTTCCTCTCCACCGCGCTGCTCGGCGCCCGCGGCGTCGCTGCCTCCTCGTCCTCTTCCGTCTCGTCTCCGGCACGGAGGCACGCGCACGTACGCTTCTGAACTCTG
CAAAATTCTCGCTGATTCAAGCTGTGCGTTTCGCGTGATTCTTAGTTGTTTTCCCCCCCACACGTTTGTATGTAGATTCAAGTCTGCTGCAAGGGCAATGTTGAGGGCCTCGAGGCTGCT
GGTCATGACGAGCGTCTGCGATTCCGTAGGAGGGATTTCATCGGCAGCTGCGTCGGGACCGCCATTGGTCTG
GTACGTGCTTGCTTTGTTAGCGGTCAATGCAGCTCTCGATTAGCGCAA
CAGAAGTGAACAACAAATGTAGCATAATGGGAAAGTTAGTTTTGTGAGGTAGCAAACTGAACTTGGTTTATGCCTTGGATTAGGAAATGATTGAGGGCTCTTCCAAATTCACGGGAGAGG
CAACTGCAGCTGATCTCATTGAGCGTAGACAACGCTCTGAGTTCCAAT
GTAGGTCACGTAACACTGTTCTTTTCCCTTCAATGATACTCTATATTATGCTTCTTAAAAAAAGGTAACTGA
AGTATTTGATTCTTTCTTCAGCAAGCATCAAGGATACCCTCTATACAGCCATAAAGGTGAGACACCTTAGCCCATTATACTCGGCATTTCTCCTTCACCTATCAATCACTCCTGTCGGCT
GAAATAGTGAAACTGAAAATCTTTTGAAGGCTAAGCCAGAGCTCGTTCCATCTTTGTTGACCTTGGCACTGAATGATGCCATCACATATGACAAGGTCTGGTCTCTGAATGGCTTTCTGT
CATTAGCATTTGGGCCTTTCTGTACGTGGTACACTTGGAAAGTTGGAAATAACCTTTGCCACTGGGCTGTTTAATTATTCCGCAGGCCACAAAAACTGGAGGTGCAAATGGATCTATCAG
GCTAG
GTAGCATCTTCTTTTTTTCTTCTGTTCTTTTTTTGTTTTGAGGGGAAAAATGCTCAGCTGAAGATGATCTAACAAGTAAATAGTTTCTTGACCTTGTTGCTCCATCATTTGATAC
TTATTTTTTCAAATAAAGCCCAGAAATAAGCAGACCTGAAAACAGTGGGCTCTCTGCTGCCTTGGATCTGCTGACTGAAGCCAAAAAGGAGATAGATTCCAATTCCAAGGGAGGTCCAAT
TTCATTTGCAGACCTGATCCAGTTTGCAG
GTTTGGCAATTTCCAGTGTAACTATACTAGCATTATTGAACCTGTTGATCTTTACTGGCGAGCGCTTCTGCACTTCTGCTAGTGTTAAATT
AAGAATCGTGTTTTTTCTTGAAACAGCACAATCAGCACTGAAGAGATCATTTCTTGATGCGGCCATTGCCAAATGTGGTGGAAATGAAGATAAGGGAAGAACCCTATACTCTGCATATGG
TTCAAACGGGCAG
GTATTCGCTGCGCCATATTGCTCCTTATGCCACATGATACTGCATATGTTCAGTCTGTCCTCGCTCCTAATTTAATGCGCTGATTTATTTTTCTTTTTGATTTTGTG
TTGTGATTATTTAACATCGCAGTGGGGCCTGTTCGACAGAACATTTGGGAGAACAGATGCACAAGATGCTGACCCAGAGGGAAGGGTACCTGATTGGAGCAAAGCTTCTGTGCAGGAGAT
GAAGGATAGGTTCGTTGCTGTTGGGTTGGGTCCTCGCCAG
GTGACCACTACTCCCTTCACAGTGATCACATTTTTCCATGAAAGAATGCAAAAACTGTCATCTAGTGTCATGCTTAACAG
ATAGGTCTCCTTTTGCAGCTTGCTGTGATGTCAGCCTTCCTCGGACCTGACCAAGCCGCTACCGAGGAACGACTGATTGCTGATCCAGATTGCCGCCCATGGGTCGAGAAGTACCAAAGG
AGTCGTGAAACAGTATCCCGGACAGACTATGAA
GTAAGCTACTGATTTTCGTTTGTGCACGAACTGCCAGTGTATCAGGAGGGTTCATCTCTCTCTTGATTGATGCTAACTTGTGCCTCT
GTGTTCTGTATGACAGGTTGACCTGATAACCGCACTCACAAAGCTGGGCTCCCTAGGCCAGAAGATAAATTATGAAGCCTACACGTACCCTAAGCAAAAGATTGACCTGGGCAAATTGAA
ACTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGGGGCGGCCTTCCTCTCCACCGCGCTGCTCGGCGCCCGCGGCGTCGCTGCCTCCTCGTCCTCTTCCGTCTCGTCTCCGGCACGGAGGCACGCGCACATTCAAGTCTGCTGCAAG
GGCAATGTTGAGGGCCTCGAGGCTGCTGGTCATGACGAGCGTCTGCGATTCCGTAGGAGGGATTTCATCGGCAGCTGCGTCGGGACCGCCATTGGTCTG
GAAATGATTGAGGGCTCTTCC
AAATTCACGGGAGAGGCAACTGCAGCTGATCTCATTGAGCGTAGACAACGCTCTGAGTTCCAAT
CAAGCATCAAGGATACCCTCTATACAGCCATAAAGGCTAAGCCAGAGCTCGTTCCA
TCTTTGTTGACCTTGGCACTGAATGATGCCATCACATATGACAAG
GCCACAAAAACTGGAGGTGCAAATGGATCTATCAGGCTAGAAATAAGCAGACCTGAAAACAGTGGGCTCTCTGCT
GCCTTGGATCTGCTGACTGAAGCCAAAAAGGAGATAGATTCCAATTCCAAGGGAGGTCCAATTTCATTTGCAGACCTGATCCAGTTTGCAG
CACAATCAGCACTGAAGAGATCATTTCTT
GATGCGGCCATTGCCAAATGTGGTGGAAATGAAGATAAGGGAAGAACCCTATACTCTGCATATGGTTCAAACGGGCAG
TGGGGCCTGTTCGACAGAACATTTGGGAGAACAGATGCACAA
GATGCTGACCCAGAGGGAAGGGTACCTGATTGGAGCAAAGCTTCTGTGCAGGAGATGAAGGATAGGTTCGTTGCTGTTGGGTTGGGTCCTCGCCAG
CTTGCTGTGATGTCAGCCTTCCTC
GGACCTGACCAAGCCGCTACCGAGGAACGACTGATTGCTGATCCAGATTGCCGCCCATGGGTCGAGAAGTACCAAAGGAGTCGTGAAACAGTATCCCGGACAGACTATGAA
GTTGACCTG
ATAACCGCACTCACAAAGCTGGGCTCCCTAGGCCAGAAGATAAATTATGAAGCCTACACGTACCCTAAGCAAAAGATTGACCTGGGCAAATTGAAACTGTGA

Retrieve as FASTA