Entry information : SiPrx115 (Si029563m)
Entry ID 9459
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status partial
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx115 (Si029563m)
Name (synonym) SiPrx115 (Si029563m)
Class Class III peroxidase     [Orthogroup: Prx174]*
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx115
start..stop
S start..stop
ZmPrx103 483 1e-170 1..292 267..560
SbPrx41 483 5e-170 1..291 326..617
OsPrx106-2 381 5e-133 1..292 93..384
OsPrx106-1 380 1e-132 1..292 93..384
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46729119..46729250 132 N° 2 46728243..46729001 759  
complement(join(46728243..46729001,46729119..46729250))


exon

Literature and cross-references SiPrx115 (Si029563m)
DNA ref. Phytozome 12:   scaffold_2 (46729250..46728243)
Protein sequence: SiPrx115 (Si029563m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   296
PWM (Da):   %s   31239.22  
PI (pH):   %s   4.97
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
VGYYRYSCPDAESIVRAAVKNATDGNRGTGAGLIRLFFHDCFVEGCDASVLLNTTGSTRPTERASVPNLSLRGFEVIDAAKAALEAACPGVVSCADIVAFAGRDATFFLSGNAVDFDMPAGRYDGHVSLDSAAIANLPPPFASLKELKDMFAAKGLDTEDMVTLSGAHTVGRSQCSSFSDRLPPNASDMNATLAASLTSQCNGTGDPTVPQDFVTPSGLDSQYYRNVLNHEVLFGSDAALLASDQTAGMVRDNAFKPGLWEDKFKAAMVKMGRAGVKNSTDGEIRKKCWMINQVSS*

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from phytozome (Short 5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTCGGCTACTACAGGTACTCATGCCCTGACGCAGAAAGCATCGTCAGGGCGGCCGTGAAAAACGCCACAGACGGTAACCGTGGCACGGGCGCTGGCCTCATTCGTTTGTTCTTCCACGAC
TGCTTCGTTGAG
GTACTACCCATCTCTTTCATTGAGCCAATTCTCAACGATGGCTAGCAATGAATGAACATATGTAGCAATACTGAAAATTCTTTTGTTCTTACGTCCTGCGACGATGGT
GTGATTCAGGGGTGCGATGCTTCAGTTCTCCTCAACACGACCGGCTCTACCCGACCGACGGAGAGGGCCAGCGTACCCAACCTGAGCCTGCGCGGCTTCGAGGTGATCGACGCGGCCAAG
GCGGCGCTCGAGGCCGCCTGCCCTGGCGTCGTCTCGTGCGCGGACATCGTCGCCTTCGCCGGCCGCGACGCTACCTTCTTCCTCAGCGGCAACGCCGTCGACTTCGACATGCCAGCGGGG
CGCTACGACGGGCACGTGTCCCTCGACAGCGCGGCCATCGCCAACCTGCCGCCGCCGTTCGCCAGCCTGAAGGAGCTCAAGGACATGTTCGCCGCCAAGGGGCTCGACACCGAGGACATG
GTCACCCTCTCCGGCGCGCACACCGTCGGCCGCTCCCAGTGCTCGTCCTTCTCCGACCGCCTCCCGCCCAACGCCTCGGACATGAACGCCACGCTCGCCGCCTCTCTGACCTCGCAGTGC
AACGGCACCGGCGACCCCACCGTGCCGCAGGACTTCGTGACACCCAGCGGCCTGGACAGCCAGTACTACAGGAACGTGCTCAACCACGAGGTGCTGTTCGGGTCGGACGCCGCGCTGCTG
GCGTCGGACCAGACGGCGGGCATGGTGAGAGACAACGCGTTCAAGCCGGGGCTGTGGGAGGACAAGTTCAAGGCGGCGATGGTGAAGATGGGCCGCGCTGGAGTCAAGAACAGCACCGAC
GGCGAGATCAGAAAGAAGTGCTGGATGATCAACCAAGTATCGAGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTCGGCTACTACAGGTACTCATGCCCTGACGCAGAAAGCATCGTCAGGGCGGCCGTGAAAAACGCCACAGACGGTAACCGTGGCACGGGCGCTGGCCTCATTCGTTTGTTCTTCCACGAC
TGCTTCGTTGAG
GGGTGCGATGCTTCAGTTCTCCTCAACACGACCGGCTCTACCCGACCGACGGAGAGGGCCAGCGTACCCAACCTGAGCCTGCGCGGCTTCGAGGTGATCGACGCGGCC
AAGGCGGCGCTCGAGGCCGCCTGCCCTGGCGTCGTCTCGTGCGCGGACATCGTCGCCTTCGCCGGCCGCGACGCTACCTTCTTCCTCAGCGGCAACGCCGTCGACTTCGACATGCCAGCG
GGGCGCTACGACGGGCACGTGTCCCTCGACAGCGCGGCCATCGCCAACCTGCCGCCGCCGTTCGCCAGCCTGAAGGAGCTCAAGGACATGTTCGCCGCCAAGGGGCTCGACACCGAGGAC
ATGGTCACCCTCTCCGGCGCGCACACCGTCGGCCGCTCCCAGTGCTCGTCCTTCTCCGACCGCCTCCCGCCCAACGCCTCGGACATGAACGCCACGCTCGCCGCCTCTCTGACCTCGCAG
TGCAACGGCACCGGCGACCCCACCGTGCCGCAGGACTTCGTGACACCCAGCGGCCTGGACAGCCAGTACTACAGGAACGTGCTCAACCACGAGGTGCTGTTCGGGTCGGACGCCGCGCTG
CTGGCGTCGGACCAGACGGCGGGCATGGTGAGAGACAACGCGTTCAAGCCGGGGCTGTGGGAGGACAAGTTCAAGGCGGCGATGGTGAAGATGGGCCGCGCTGGAGTCAAGAACAGCACC
GACGGCGAGATCAGAAAGAAGTGCTGGATGATCAACCAAGTATCGAGCTAA

Retrieve as FASTA