Entry information : SiPrx117 (Si030214m)
Entry ID 9461
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx117 (Si030214m)
Name (synonym) SiPrx117 (Si030214m)
Class Class III peroxidase    [Orthogroup: Prx134]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx117
start..stop
S start..stop
ZmPrx109 352 1e-120 34..370 32..360
HvPrx64 321 1e-108 1..371 1..357
TaPrx47 308 1e-103 11..371 11..360
HvPrx104 305 1e-102 34..371 28..355
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46723955..46724308 354 N° 2 46723093..46723857 765  
complement(join(46723093..46723857,46723955..46724308))


exon

Literature and cross-references SiPrx117 (Si030214m)
DNA ref. Phytozome 12:   scaffold_2 (46724308..46723093)
Protein sequence: SiPrx117 (Si030214m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   373 (346)
PWM (Da):   %s   39583.04 (37078.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.29 (6.51) Peptide Signal:   %s   cut: 27 range:27-372
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASKKLATAAVLVSLLALLVGPSAGLLDLCPVFVGWGALQSLLNSLICGLPGGNYTPPTVPSNPLGFGYYNNSNNNASYCPDAEAAVTAAVEKAIKQQGRGVGAGIIRLFFHDAFVRGCDASVLLNNTVAAGNNTEREGPPNKDSLRGFDVIDAAKEATKAACGGRNVVSCADILALAARDASHILSNGRIKFAMPTGRFDGRESFARETIQLPGPDSTLEDLVRMFKVQGLNETDVVTLSGAHSIGRARCLFLTKDRLSAMNSTYAGQLNETCKINDTVNQDPFSPDRDPNNLDNQYYKNIDKFVLFKSDAVLLSSETTKKQVEANAANATKFEADFAAAMVKMGNIGVKTTHVPGVTEIREVCWRVNNA*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCAGCAAGAAGCTTGCCACCGCCGCCGTCCTCGTCAGCTTGCTGGCGCTCCTCGTCGGGCCCTCGGCGGGCCTGCTGGACCTCTGCCCCGTCTTCGTAGGCTGGGGGGCCCTC
CAGAGCTTATTGAACTCCCTCATATGTGGGCTCCCGGGCGGCAATTACACTCCTCCCACCGTCCCGAGTAATCCGCTCGGTTTCGGCTACTACAACAACTCCAACAACAATGCCTCCTAC
TGCCCCGACGCGGAAGCCGCCGTGACGGCCGCCGTGGAGAAGGCCATCAAGCAGCAGGGCCGCGGCGTTGGCGCCGGCATCATCCGCCTCTTCTTCCACGACGCCTTCGTCCGG
GTACGT
GCAGTGCAGCTAGCTCTCATTCCTTGTCTTGCTTGGACGACGCTGCCTGTGAGATGTGACGAGCGACGTCAAACATATCGTTCTTGTTCAGGGCTGCGATGCCTCCGTCCTCCTCAACAA
CACGGTCGCCGCGGGGAACAACACGGAGAGGGAAGGCCCTCCCAACAAGGACAGCCTGCGCGGGTTCGACGTGATCGACGCGGCCAAGGAGGCGACCAAGGCCGCCTGCGGCGGCCGCAA
CGTGGTGTCGTGCGCCGACATCCTCGCCCTTGCTGCCCGCGACGCGTCCCACATCCTCAGCAACGGCAGGATCAAGTTCGCCATGCCGACGGGGCGCTTCGACGGGCGCGAGTCCTTCGC
CAGGGAGACCATCCAGCTGCCCGGACCGGACTCCACCCTGGAGGACCTCGTGAGGATGTTCAAAGTCCAGGGGCTCAACGAAACCGACGTGGTCACCCTCTCCGGCGCGCACAGCATCGG
CCGCGCCCGCTGCCTGTTCCTCACGAAGGACCGCCTGTCGGCCATGAACTCCACGTACGCCGGTCAGCTGAATGAGACCTGCAAGATCAACGACACGGTGAACCAGGACCCCTTCAGCCC
CGACCGCGACCCCAACAACCTGGACAACCAGTACTACAAGAACATCGACAAGTTCGTGCTGTTCAAATCGGACGCCGTGCTCCTGTCGTCGGAGACGACCAAGAAGCAGGTGGAGGCGAA
CGCCGCCAATGCGACCAAGTTTGAGGCCGACTTCGCGGCGGCGATGGTGAAGATGGGCAACATCGGGGTCAAGACCACCCACGTCCCCGGCGTCACCGAGATCAGGGAGGTGTGCTGGAG
GGTCAACAACGCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCAGCAAGAAGCTTGCCACCGCCGCCGTCCTCGTCAGCTTGCTGGCGCTCCTCGTCGGGCCCTCGGCGGGCCTGCTGGACCTCTGCCCCGTCTTCGTAGGCTGGGGGGCCCTC
CAGAGCTTATTGAACTCCCTCATATGTGGGCTCCCGGGCGGCAATTACACTCCTCCCACCGTCCCGAGTAATCCGCTCGGTTTCGGCTACTACAACAACTCCAACAACAATGCCTCCTAC
TGCCCCGACGCGGAAGCCGCCGTGACGGCCGCCGTGGAGAAGGCCATCAAGCAGCAGGGCCGCGGCGTTGGCGCCGGCATCATCCGCCTCTTCTTCCACGACGCCTTCGTCCGG
GGCTGC
GATGCCTCCGTCCTCCTCAACAACACGGTCGCCGCGGGGAACAACACGGAGAGGGAAGGCCCTCCCAACAAGGACAGCCTGCGCGGGTTCGACGTGATCGACGCGGCCAAGGAGGCGACC
AAGGCCGCCTGCGGCGGCCGCAACGTGGTGTCGTGCGCCGACATCCTCGCCCTTGCTGCCCGCGACGCGTCCCACATCCTCAGCAACGGCAGGATCAAGTTCGCCATGCCGACGGGGCGC
TTCGACGGGCGCGAGTCCTTCGCCAGGGAGACCATCCAGCTGCCCGGACCGGACTCCACCCTGGAGGACCTCGTGAGGATGTTCAAAGTCCAGGGGCTCAACGAAACCGACGTGGTCACC
CTCTCCGGCGCGCACAGCATCGGCCGCGCCCGCTGCCTGTTCCTCACGAAGGACCGCCTGTCGGCCATGAACTCCACGTACGCCGGTCAGCTGAATGAGACCTGCAAGATCAACGACACG
GTGAACCAGGACCCCTTCAGCCCCGACCGCGACCCCAACAACCTGGACAACCAGTACTACAAGAACATCGACAAGTTCGTGCTGTTCAAATCGGACGCCGTGCTCCTGTCGTCGGAGACG
ACCAAGAAGCAGGTGGAGGCGAACGCCGCCAATGCGACCAAGTTTGAGGCCGACTTCGCGGCGGCGATGGTGAAGATGGGCAACATCGGGGTCAAGACCACCCACGTCCCCGGCGTCACC
GAGATCAGGGAGGTGTGCTGGAGGGTCAACAACGCTTAG

Retrieve as FASTA