Entry information : SiPrx13 (Si002089m)
Entry ID 9475
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-12 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-12 (Qiang Li)
Peroxidase information: SiPrx13 (Si002089m)
Name (synonym) SiPrx13 (Si002089m)
Class Class III peroxidase    [Orthogroup: Prx175]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx13
start..stop
S start..stop
SbPrx67 525 0 17..343 23..348
ZmPrx124 504 0 27..343 26..342
BdiPrx94 484 8e-174 1..343 1..335
OsPrx19 476 1e-170 3..343 4..336
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 38902418..38902468 51 N° 2 38902211..38902378 168 N° 3 38901807..38901992 186 N° 4 38901521..38901686 166
N° 5 38900970..38901388 419  
complement(join(38900970..38901388,38901521..38901686,38901807..38901992,3890221 1..38902378,38902418..38902468))


exon

Literature and cross-references SiPrx13 (Si002089m)
DNA ref. Phytozome 12:   scaffold_5 (38902468..38900970)
Protein sequence: SiPrx13 (Si002089m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344
PWM (Da):   %s   36991.37  
PI (pH):   %s   4.6
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALGLPLLLVVVVVAASSRAGLADPAPAAVSALPGLPVAGLAVGFYNASCPEVEDLVLAEMRAIVAKDRTLGPALLRFMFHDCLVRGCDASIMLESRSKKGEQDAVPSYGLRGYEEVERIKAKVEEACPLTVSCADIIALAARDAVYLSNGPRYAVETGRRDGKVSAKSDADNDLPPPFSNIVDLKTYFSVKGLGWKDLVVLSGSHTIGSAQCSSFASDRLYNYSGRGVQDPSLNKTFAAGLREACEAGRENDTTPVYMDSTTPYDFDLGYYRDVLSNTSLFLSDKALMDDRWTRTYVERMAAAASPDEFFDDYAVAMTNMGRLEVLTGDNGEIRKTCTSYVD*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTGGGGCTGCCGCTGCTGCTGGTGGTGGTGGTCGTCGCCGCGAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGCGCGCTGCCGGGGCTCCCGGTCGCCGGG
CTCGCCGTCGGGTTCTACAACGCGTCGTGCCCGGAGGTGGAGGATCTGGTCCTCGCCGAGATGCGCGCCATCGTCGCCAAGGACAGGACCCTCGGCCCCGCGCTGCTGCGGTTCATGTTC
CACGACTGCCTCGTCAGG
GTGCGTTCGTTGCGCTTCTTCAATTTCTCTAGCTTCAGTTCATCCGCTCGTTACGTTTCAAAAAAAAAAAAAAGGTTCATCCGCTCGTGCTCCGTGCTCCTC
GTGTCCGTGTTCTGCGTGTGCGTGTCCCGTCGCGTGCACGAAATGAGAAACACGAGTGATTGGTGCGTCGCCGTGGCGGTTGGTGACGCGGCTTTCCTGGATGATTTTGCCTTCAGGGTT
GCGACGCGTCGATCATGCTCGAGTCGCGGAGCAAGAAGGGGGAGCAGGACGCCGTCCCGAGCTACGGCCTCCGCGGCTACGAGGAGGTCGAACGGATCAAGGCCAAGGTGGAGGAGGCGT
GCCCGCTCACCGTGTCGTGCGCGGACATCATCGCCTTGGCGGCCCGGGACGCCGTGTACCTG
GTAAGCGCCATCCATTGGTCAAATGCATTCGTGAGCGAGCTCGAATGCTCGATCATCG
TGGTGTTCATCGCTTTCCTCTGATCCACGTTGACAAGCGGCGGCTGTTCCCCATTTCTGCAGAGCAACGGGCCGCGCTACGCCGTGGAGACCGGGCGCCGGGACGGCAAGGTGTCGGCCA
AGTCCGACGCCGACAACGACCTCCCGCCGCCCTTCTCCAACATCGTCGACCTCAAGACATACTTCAGCGTCAAGGGCTTGGGCTGGAAGGACCTCGTCGTCCTATCAG
GTAGCATAAATT
ATACTACCCACAAAAAATCAATGAACTAGCTAGCTTCCATTGGAATTTGGAAGTGCAAGCAAAGCTTCCAACCAACAACCGATTGCCCAATAATCCTTCCCGATCGTCATCAACCCGCAG

GGAGCCACACGATCGGGAGTGCGCAGTGCTCGTCGTTCGCGTCGGACCGCCTCTACAACTACAGCGGGAGAGGGGTGCAGGACCCGTCGCTGAACAAGACGTTCGCGGCGGGGCTGCGGG
AGGCGTGCGAGGCCGGGCGCGAGAACGACACCACCCCGGTGTACATGGACTCCACCACCCCCTACGACTTCGACCTGGGCTACTACCGCGACGTGCTCAGCAACACGAGCCTGTTCCTCT
CCGACAAGGCGCTCATGGACGACCGGTGGACCAGGACGTACGTGGAGCGGATGGCCGCCGCGGCGTCGCCCGACGAGTTCTTCGACGACTACGCGGTCGCCATGACCAACATGGGCAGGC
TCGAGGTGCTCACGGGCGATAACGGAGAGATCAGGAAGACCTGCACCTCGTACGTTGAC

Retrieve as FASTA