Entry information : SiPrx131 (Si030597m)
Entry ID 9476
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx131 (Si030597m)
Name (synonym) SiPrx131 (Si030597m)
Class Class III peroxidase    [Orthogroup: Prx120]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx131
start..stop
S start..stop
PviPrx09 504 0 2..312 19..336
SiPrx129 503 0 1..312 1..312
TmPrx01 440 4e-157 2..312 3..312
HvPrx17 440 4e-157 2..312 3..313
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 48186140..48186343 204 N° 2 48186423..48186605 183 N° 3 48186701..48186866 166 N° 4 48187023..48187408 386
join(48186140..48186343,48186423..48186605,48186701..48186866,48187023..48187408 )


exon

Literature and cross-references SiPrx131 (Si030597m)
DNA ref. Phytozome 12:   scaffold_2 (48186140..48187408)
Protein sequence: SiPrx131 (Si030597m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   313 (291)
PWM (Da):   %s   32717.16 (30700.1)  
PI (pH):   %s   5.99 (5.99) Peptide Signal:   %s   cut: 22 range:22-312
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASASFLGLLVLVALASGASAQLSPTFYDTSCPNALSTIRTAVNAAVAQEARMGASLLRLHFHDCFVQGCDASVLLNDTNGEQSAGPNVGSLRGFGVIDNIKAQVEALCPQTVSCADILTVAARDSVVALGGPSWTVLLGRRDSTSSFPNQANTDLPAPQSSLRNLIDAFGNKTLSATDMVALSGAHTIGQAQCTNFRDHITESNINPAFAASLRTSCPATGGDTNLAPLDVTTPNTFDNAYYNNLLSQRGLLHSDQELFNNGSTDSTVRNFASNAAAFSSAFTTAMVKMANIQPLTGTQGQIRRLCWRVNS*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTGCTTCTTTCCTTGGGTTGTTGGTGCTCGTGGCGCTGGCCTCTGGGGCGTCGGCGCAGCTGTCGCCGACGTTCTACGACACGTCGTGCCCCAACGCGCTGTCCACCATCAGG
ACCGCCGTGAACGCCGCGGTGGCGCAGGAGGCTCGCATGGGGGCGTCCCTGCTCAGGCTGCACTTCCACGATTGCTTTGTCCAA
GCAAGTCTCACACGCATAACCCTTGATCTTTTCCTT
GTCTGTTCTTTAATTTGACAGTCGATCATCCAAATTTGAGCAGGGCTGCGACGCTTCCGTTCTGCTGAATGACACGAACGGCGAGCAGAGCGCGGGTCCGAACGTGGGATCGCTGAGAGG
CTTCGGCGTCATCGACAACATCAAGGCACAGGTGGAGGCTTTGTGCCCGCAGACCGTCTCCTGCGCCGACATCCTCACCGTCGCCGCCCGCGACTCCGTCGTAGCG
GTGAGATCATTAGC
ACGCGATGTCTTTCTGTGTGTTGATTGTTACCCTGATGCTTCTACTCTGTTGCTGTTGGCTTGTAACTAACTTGTATGCAGCTCGGCGGGCCTTCGTGGACTGTTCTACTGGGAAGAAGG
GACTCTACCAGTTCATTCCCGAACCAGGCAAATACCGACCTCCCAGCTCCTCAATCTAGCCTCCGAAATCTTATAGATGCGTTTGGGAATAAGACCCTCTCCGCAACAGACATGGTTGCT
CTCTCAG
GTGCATGCCCCTAGCTAGAACAGTTCGTGTTAATTCTTCTCATCGATCAGTAGATACATTTGAATCTTTGATATGGCAGTGGCAGACACGAGCCCAGGACTCCAAGGTTTCCA
TTTGTTTCAAAACTGACGATGCAGGCGAACCTTTAATTTGCAGGCGCTCACACTATCGGACAGGCGCAGTGCACGAACTTCCGGGACCATATCACCGAGAGCAACATCAACCCCGCCTTC
GCCGCGTCGCTCAGGACCAGCTGCCCCGCGACAGGCGGCGACACCAACCTGGCGCCGCTGGACGTCACGACGCCCAACACCTTCGACAACGCCTACTACAACAACCTGCTGTCCCAAAGG
GGGCTCCTGCACTCGGACCAGGAGCTATTCAACAACGGCAGCACCGACAGCACGGTCAGGAACTTCGCGTCCAACGCTGCGGCGTTCAGCAGCGCCTTCACGACGGCCATGGTGAAGATG
GCTAACATTCAGCCGCTGACCGGGACACAGGGCCAGATCAGGCGCCTCTGCTGGAGGGTCAACTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTGCTTCTTTCCTTGGGTTGTTGGTGCTCGTGGCGCTGGCCTCTGGGGCGTCGGCGCAGCTGTCGCCGACGTTCTACGACACGTCGTGCCCCAACGCGCTGTCCACCATCAGG
ACCGCCGTGAACGCCGCGGTGGCGCAGGAGGCTCGCATGGGGGCGTCCCTGCTCAGGCTGCACTTCCACGATTGCTTTGTCCAA
GGCTGCGACGCTTCCGTTCTGCTGAATGACACGAAC
GGCGAGCAGAGCGCGGGTCCGAACGTGGGATCGCTGAGAGGCTTCGGCGTCATCGACAACATCAAGGCACAGGTGGAGGCTTTGTGCCCGCAGACCGTCTCCTGCGCCGACATCCTCACC
GTCGCCGCCCGCGACTCCGTCGTAGCG
CTCGGCGGGCCTTCGTGGACTGTTCTACTGGGAAGAAGGGACTCTACCAGTTCATTCCCGAACCAGGCAAATACCGACCTCCCAGCTCCTCAA
TCTAGCCTCCGAAATCTTATAGATGCGTTTGGGAATAAGACCCTCTCCGCAACAGACATGGTTGCTCTCTCAG
GCGCTCACACTATCGGACAGGCGCAGTGCACGAACTTCCGGGACCAT
ATCACCGAGAGCAACATCAACCCCGCCTTCGCCGCGTCGCTCAGGACCAGCTGCCCCGCGACAGGCGGCGACACCAACCTGGCGCCGCTGGACGTCACGACGCCCAACACCTTCGACAAC
GCCTACTACAACAACCTGCTGTCCCAAAGGGGGCTCCTGCACTCGGACCAGGAGCTATTCAACAACGGCAGCACCGACAGCACGGTCAGGAACTTCGCGTCCAACGCTGCGGCGTTCAGC
AGCGCCTTCACGACGGCCATGGTGAAGATGGCTAACATTCAGCCGCTGACCGGGACACAGGGCCAGATCAGGCGCCTCTGCTGGAGGGTCAACTCGTAA

Retrieve as FASTA