Entry information : SiPrx145 (Si036119m)
Entry ID 9487
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx145 (Si036119m)
Name (synonym) SiPrx145 (Si036119m)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx145
start..stop
S start..stop
SbPrx20 627 0 4..340 3..337
ZmPrx25 617 0 6..340 4..336
ZmPrx138 555 0 17..340 7..326
OsPrx39 520 0 37..340 28..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 51835366..51835614 249 N° 2 51835700..51835891 192 N° 3 51836425..51836587 163 N° 4 51836706..51837121 416
join(51835366..51835614,51835700..51835891,51836425..51836587,51836706..51837121 )


exon

Literature and cross-references SiPrx145 (Si036119m)
DNA ref. Phytozome 12:   scaffold_9 (51835366..51837121)
Protein sequence: SiPrx145 (Si036119m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341 (312)
PWM (Da):   %s   36377.33 (33430.8)  
PI (pH):   %s   8.41 (7.94) Peptide Signal:   %s   cut: 29 range:29-340
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPSRRGRMSCSPHQLVVVLLSAAAALGFGVRAGAAQLCGEYYDRTCPDVHRIVRRVLKKAHEADARIYASLTRLHFHDCFVQGCDGSILLDNSSSIVSEKFAAPNNNSARGYPVVDAVKAALEEACPGVVSCADILAIAAKISVELSGGPRWRVPLGRRDGTTANITAANDLPSPFDNLTALQQKFGAVGLDDTDLVALSGAHTFGRVQCQFVTPRLYNFSGTNRPDPTLDRGYRAFLSLRCPRGGDGTALNDLDPTTPDAFDNSYYTNIEARRGTLQSDQELLSTPGAPTAAIVGRFAGSQKAFFKSFARSMINMGNIEVLTGSQGEVRKNCRVVNGS*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Extra 5' end has been removed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCCGTCGCGCCGTGGCCGCATGTCGTGTAGTCCTCATCAGCTGGTCGTCGTCCTGCTGTCCGCCGCCGCCGCGCTGGGGTTCGGCGTCCGGGCCGGCGCGGCGCAGCTGTGCGGA
GAGTACTACGACCGGACGTGCCCCGACGTGCACCGGATCGTGCGGCGGGTGCTGAAGAAGGCGCACGAGGCCGACGCGCGCATCTACGCCAGCCTCACCCGCCTCCACTTCCACGACTGC
TTCGTCCAG
GTAATAAGAAGGCCACAGCGCCCCGCGTTTGCTTATCGCTCTGTCCGCGACGTTCTGAGCTCATGTGCGTGCTGTGTTTCTCCAGGGCTGCGACGGGTCGATCCTGCTGGA
CAACAGCTCGAGCATCGTGTCGGAGAAGTTCGCGGCGCCCAACAACAACTCGGCGCGCGGGTACCCCGTGGTGGACGCCGTCAAGGCCGCGCTGGAGGAAGCATGCCCCGGCGTCGTCTC
CTGCGCCGACATCCTCGCCATCGCCGCCAAGATCTCCGTCGAGCTG
GTGAGGTTTTTCTCCCTCTTTTTTTTTTCTCTAGTAGCAGCCTGCAAATGTACGCAACGATCGATCGGTGCACC
ATTAGCCCTCACTAATGCACTAAGTACCACATTAAACTCGTTTGGAGCTTGAAGCTGTTAAACGTTATTAATGAACTGATGATTAACAAACCGGCATTGTTCACGAAGATTTGACGCGAG
CACAGCAGCAGACTGTCGACTGGCACTGCACTAGGCCGGAAGGCAATAATTTTGTAGCTCCGAGCCTGGACCTGGAGCAATAATTCCAAAGCCGTCGGTGCAAAAATAATTGAACTAGCT
AGTGGAGATCTATGAGAAGAAGCTGACAAAACCGCGCAATTTTAAAGGCATGCAAAACAGTAGTACTACGGCGTGGATATTCACACGTCACGTCCATCGGCTCTCAGCACGGTCTCTAGT
TAGGTCGCGCCAATCCTTTCCGTGCCGCTCTTTAATCCAGCACGGCCACATGACGCGTGGGTCCCATGTCTGCATGCACGCACGGACGCACGCATGCAGTCCGGCGGGCCCCGGTGGCGC
GTGCCGCTCGGCCGGCGCGACGGCACCACCGCCAACATCACCGCCGCCAACGACCTCCCGAGCCCCTTCGACAACCTCACCGCGCTCCAGCAGAAGTTCGGCGCCGTCGGCCTCGACGAC
ACCGACCTCGTCGCCCTCTCAG
GTAAAAGGAGACCCCAACTCCATCGTCAACCGGTGCCTCTCGTCATCATCATCCTGCACGAACAGAGATGAGATCGAGATCATGGCGATTTACCTCAG
CTCGCTCTCGCTGCTTGCAGGGGCGCACACGTTCGGGCGGGTGCAGTGCCAGTTCGTGACGCCGCGGCTGTACAACTTCAGCGGGACGAACCGGCCGGACCCGACGCTGGACAGGGGGTA
CCGGGCGTTCCTCTCCCTGCGGTGCCCCAGGGGCGGGGACGGGACGGCGCTCAACGACCTCGACCCGACCACGCCGGACGCCTTCGACAACAGCTACTACACCAACATCGAGGCGCGCCG
GGGGACGCTGCAGTCCGACCAGGAGCTGCTGTCGACGCCCGGCGCGCCCACGGCGGCGATCGTCGGCCGGTTCGCCGGCAGTCAGAAGGCGTTCTTCAAGAGCTTCGCGAGGTCCATGAT
CAACATGGGGAACATCGAGGTGCTGACGGGGAGCCAGGGTGAGGTCAGGAAGAACTGTAGAGTGGTCAATGGAAGC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCCGTCGCGCCGTGGCCGCATGTCGTGTAGTCCTCATCAGCTGGTCGTCGTCCTGCTGTCCGCCGCCGCCGCGCTGGGGTTCGGCGTCCGGGCCGGCGCGGCGCAGCTGTGCGGA
GAGTACTACGACCGGACGTGCCCCGACGTGCACCGGATCGTGCGGCGGGTGCTGAAGAAGGCGCACGAGGCCGACGCGCGCATCTACGCCAGCCTCACCCGCCTCCACTTCCACGACTGC
TTCGTCCAG
GGCTGCGACGGGTCGATCCTGCTGGACAACAGCTCGAGCATCGTGTCGGAGAAGTTCGCGGCGCCCAACAACAACTCGGCGCGCGGGTACCCCGTGGTGGACGCCGTCAAG
GCCGCGCTGGAGGAAGCATGCCCCGGCGTCGTCTCCTGCGCCGACATCCTCGCCATCGCCGCCAAGATCTCCGTCGAGCTG
TCCGGCGGGCCCCGGTGGCGCGTGCCGCTCGGCCGGCGC
GACGGCACCACCGCCAACATCACCGCCGCCAACGACCTCCCGAGCCCCTTCGACAACCTCACCGCGCTCCAGCAGAAGTTCGGCGCCGTCGGCCTCGACGACACCGACCTCGTCGCCCTC
TCAG
GGGCGCACACGTTCGGGCGGGTGCAGTGCCAGTTCGTGACGCCGCGGCTGTACAACTTCAGCGGGACGAACCGGCCGGACCCGACGCTGGACAGGGGGTACCGGGCGTTCCTCTCC
CTGCGGTGCCCCAGGGGCGGGGACGGGACGGCGCTCAACGACCTCGACCCGACCACGCCGGACGCCTTCGACAACAGCTACTACACCAACATCGAGGCGCGCCGGGGGACGCTGCAGTCC
GACCAGGAGCTGCTGTCGACGCCCGGCGCGCCCACGGCGGCGATCGTCGGCCGGTTCGCCGGCAGTCAGAAGGCGTTCTTCAAGAGCTTCGCGAGGTCCATGATCAACATGGGGAACATC
GAGGTGCTGACGGGGAGCCAGGGTGAGGTCAGGAAGAACTGTAGAGTGGTCAATGGAAGC

Retrieve as FASTA