Entry information : SiPrx148 (Si036455m)
Entry ID 9490
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx148 (Si036455m)
Name (synonym) SiPrx148 (Si036455m)
Class Class III peroxidase    [Orthogroup: Prx095]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx148
start..stop
S start..stop
ZmPrx02 584 0 16..326 27..335
SbPrx16 574 0 16..326 17..328
HvPrx28 569 0 3..326 10..332
TaPrx44 569 0 1..326 8..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45543652..45543858 207 N° 2 45542742..45543512 771  
complement(join(45542742..45543512,45543652..45543858))


exon

Literature and cross-references SiPrx148 (Si036455m)
DNA ref. Phytozome 12:   scaffold_9 (45543858..45542742)
Protein sequence: SiPrx148 (Si036455m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (308)
PWM (Da):   %s   35068.51 (33085.4)  
PI (pH):   %s   5.61 (5.15) Peptide Signal:   %s   cut: 19 range:19-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPVLAALTLLLLAVACRASPYYPLELGYYRYKCPQAEAIVKAVMEKAIGQNPGNGAAVIRMLFHDCFVEGCDASILLDPTPFSPTPEKLSPPNNPSLRGFELIDAIKHALEAACPGVVSCADIIAFAARDASCFLSHGRVSFDMPAGRLDGTFSNASEPLKFLVPPTSNLSDLISSFVVKGMSVEDLVVLSGAHTVGQSHCSSFVSDRLDVPSDINPGLAGFLRSRCPANATSGSGDDPTVVQDVVTPNDMDSQYYRNVLSHTVLFTSDAALLTSPETAKMVVENAKIPGWWEDRFEKAMVKMASIEVKTGYQGQVRKNCRAINHY*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCGTTTTGGCCGCACTCACCTTGCTGCTCCTAGCCGTGGCGTGCCGGGCCAGCCCGTACTACCCTCTGGAGCTAGGGTACTACCGTTACAAGTGCCCCCAGGCTGAGGCCATCGTG
AAGGCCGTCATGGAGAAGGCCATCGGCCAGAACCCCGGCAATGGCGCCGCCGTCATCCGGATGCTCTTCCACGACTGCTTCGTCGAG
GTATTTTATCATTTAATTTACATATCATCAGAG
TGCGCCAAATTATAGTTAGTGCAAATAACAGATTTATATTGCAAGTACTATATAGTATATACTCTGACAAGGTTAGGTAAGCTAAACTTGTTTCATGGTTGACTAGGGCTGTGATGCTTC
CATCCTTCTGGACCCGACCCCGTTCAGCCCGACGCCGGAGAAGCTGAGCCCGCCCAACAACCCGAGCCTGCGCGGCTTCGAGCTGATCGACGCGATCAAGCACGCGCTCGAGGCGGCCTG
CCCCGGCGTCGTCTCCTGCGCCGACATCATCGCCTTCGCGGCCCGCGACGCGTCCTGCTTCCTCAGCCACGGCAGGGTCAGCTTCGACATGCCGGCGGGCCGCCTCGACGGCACCTTCTC
CAACGCCTCCGAACCGCTCAAGTTCCTGGTCCCGCCGACGTCCAACCTCAGCGACCTTATCTCCAGCTTCGTCGTCAAGGGGATGTCAGTGGAGGACCTCGTCGTCCTCTCCGGCGCGCA
CACCGTCGGGCAGTCCCACTGCTCGTCCTTCGTCTCCGACCGCCTCGACGTCCCCTCCGATATCAACCCGGGGCTGGCCGGGTTCCTCAGGAGCCGATGCCCGGCCAACGCGACGAGCGG
CAGCGGCGACGACCCGACGGTGGTGCAGGACGTGGTGACGCCCAACGACATGGACAGCCAGTACTACAGGAACGTGCTGTCGCACACCGTGCTGTTCACCTCCGACGCGGCGCTGCTGAC
ATCGCCGGAGACGGCGAAGATGGTGGTGGAGAACGCCAAAATCCCCGGGTGGTGGGAGGACAGGTTCGAGAAGGCCATGGTGAAGATGGCCAGCATCGAGGTGAAGACCGGGTACCAGGG
GCAGGTCAGGAAGAACTGCAGGGCGATAAACCACTAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCGTTTTGGCCGCACTCACCTTGCTGCTCCTAGCCGTGGCGTGCCGGGCCAGCCCGTACTACCCTCTGGAGCTAGGGTACTACCGTTACAAGTGCCCCCAGGCTGAGGCCATCGTG
AAGGCCGTCATGGAGAAGGCCATCGGCCAGAACCCCGGCAATGGCGCCGCCGTCATCCGGATGCTCTTCCACGACTGCTTCGTCGAG
GGCTGTGATGCTTCCATCCTTCTGGACCCGACC
CCGTTCAGCCCGACGCCGGAGAAGCTGAGCCCGCCCAACAACCCGAGCCTGCGCGGCTTCGAGCTGATCGACGCGATCAAGCACGCGCTCGAGGCGGCCTGCCCCGGCGTCGTCTCCTGC
GCCGACATCATCGCCTTCGCGGCCCGCGACGCGTCCTGCTTCCTCAGCCACGGCAGGGTCAGCTTCGACATGCCGGCGGGCCGCCTCGACGGCACCTTCTCCAACGCCTCCGAACCGCTC
AAGTTCCTGGTCCCGCCGACGTCCAACCTCAGCGACCTTATCTCCAGCTTCGTCGTCAAGGGGATGTCAGTGGAGGACCTCGTCGTCCTCTCCGGCGCGCACACCGTCGGGCAGTCCCAC
TGCTCGTCCTTCGTCTCCGACCGCCTCGACGTCCCCTCCGATATCAACCCGGGGCTGGCCGGGTTCCTCAGGAGCCGATGCCCGGCCAACGCGACGAGCGGCAGCGGCGACGACCCGACG
GTGGTGCAGGACGTGGTGACGCCCAACGACATGGACAGCCAGTACTACAGGAACGTGCTGTCGCACACCGTGCTGTTCACCTCCGACGCGGCGCTGCTGACATCGCCGGAGACGGCGAAG
ATGGTGGTGGAGAACGCCAAAATCCCCGGGTGGTGGGAGGACAGGTTCGAGAAGGCCATGGTGAAGATGGCCAGCATCGAGGTGAAGACCGGGTACCAGGGGCAGGTCAGGAAGAACTGC
AGGGCGATAAACCACTAC

Retrieve as FASTA