Entry information : SiPrx156 (Si036567m)
Entry ID 9499
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx156 (Si036567m)
Name (synonym) SiPrx156 (Si036567m)
Class Class III peroxidase    [Orthogroup: Prx128]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx156
start..stop
S start..stop
SiPrx158 534 0 1..330 1..329
SbPrx09 532 0 14..330 14..331
ZmPrx126 523 0 27..330 13..317
SbPrx11 513 0 26..330 25..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 36443294..36443527 234 N° 2 36442446..36443201 756  
complement(join(36442446..36443201,36443294..36443527))


exon

Literature and cross-references SiPrx156 (Si036567m)
DNA ref. Phytozome 12:   scaffold_9 (36443527..36442446)
Protein sequence: SiPrx156 (Si036567m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (301)
PWM (Da):   %s   35427.03 (32818.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.74 (8.60) Peptide Signal:   %s   cut: 30 range:30-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASAARNGAAAAALMVAVAVLALAGGGSAQLQHGFYKGKCNGTDVEAVVQSIVRARFARENPIVAYLLRMQFHECVINGCDAGLLIDGTGTEKTAPPNLSVKGYDVIADIKAELERRCPGVVSCSDIQILATRDAVALAGGAAYAVRTGRRDRRRSQASDVKLPAPEYTAQQTTAYYGRLGLSAFDTVLLLGAHTVGATRCSVIKSRLYGYGGRPGATDPGMDPAYASIYKKYVCPNMPSSDNNVVFLDDQWSALKVDNHYYKNIQLRRGVLPCDQNLYNDGSTRWIVDLLANNDGLFTSAFPQALIKLSEVGVLTGMQGEIRKVCNRFN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCAGCAGCGCGCAATGGTGCCGCGGCGGCGGCGCTAATGGTGGCCGTCGCCGTGCTGGCCCTGGCCGGCGGCGGCAGCGCCCAGCTGCAGCACGGGTTCTACAAGGGCAAGTGC
AACGGTACCGACGTGGAGGCGGTGGTGCAGAGCATCGTCAGGGCCCGGTTCGCGCGCGAGAACCCCATCGTCGCCTACCTCCTCCGCATGCAGTTCCACGAGTGCGTCATCAAC
GTACGT
GCCAGCGAGCGAGCGAGCTACCCGGTGTCCATGTCCCTTGCACGCACGGGTGGTAAATTAACGTGACAGCTACCATATATATGCAGGGCTGCGACGCCGGTCTCCTGATCGACGGCACCG
GCACGGAGAAGACGGCGCCGCCGAACCTGAGCGTGAAGGGCTACGATGTGATCGCGGACATCAAGGCGGAGCTGGAGCGGCGGTGCCCCGGCGTGGTGTCCTGCTCCGACATCCAGATCC
TCGCCACCAGGGACGCCGTCGCGCTTGCCGGCGGCGCCGCCTACGCGGTGCGCACGGGGCGGAGAGACCGCCGCCGGTCGCAGGCCTCCGACGTCAAGCTCCCGGCGCCCGAGTACACGG
CGCAGCAGACGACGGCGTACTACGGGCGGCTGGGGCTGAGCGCGTTCGACACGGTGCTGCTGCTGGGCGCGCACACCGTCGGCGCCACGCGCTGCAGCGTCATCAAGAGCAGGCTCTACG
GGTACGGCGGCCGGCCCGGCGCGACGGACCCCGGCATGGACCCGGCCTACGCGTCCATCTACAAGAAGTACGTGTGCCCCAACATGCCGTCGTCGGACAACAACGTGGTGTTCCTGGACG
ACCAGTGGAGCGCGCTCAAGGTGGACAACCACTACTACAAGAACATCCAGCTCCGCCGGGGGGTGCTCCCCTGCGACCAGAACCTGTACAACGACGGCTCCACGAGGTGGATCGTGGACC
TGCTCGCCAACAACGACGGCCTCTTCACCTCGGCCTTCCCGCAGGCGCTCATCAAGCTCAGCGAGGTCGGCGTGCTCACCGGCATGCAGGGGGAGATCCGCAAGGTCTGCAACAGGTTCA
AC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCAGCAGCGCGCAATGGTGCCGCGGCGGCGGCGCTAATGGTGGCCGTCGCCGTGCTGGCCCTGGCCGGCGGCGGCAGCGCCCAGCTGCAGCACGGGTTCTACAAGGGCAAGTGC
AACGGTACCGACGTGGAGGCGGTGGTGCAGAGCATCGTCAGGGCCCGGTTCGCGCGCGAGAACCCCATCGTCGCCTACCTCCTCCGCATGCAGTTCCACGAGTGCGTCATCAAC
GGCTGC
GACGCCGGTCTCCTGATCGACGGCACCGGCACGGAGAAGACGGCGCCGCCGAACCTGAGCGTGAAGGGCTACGATGTGATCGCGGACATCAAGGCGGAGCTGGAGCGGCGGTGCCCCGGC
GTGGTGTCCTGCTCCGACATCCAGATCCTCGCCACCAGGGACGCCGTCGCGCTTGCCGGCGGCGCCGCCTACGCGGTGCGCACGGGGCGGAGAGACCGCCGCCGGTCGCAGGCCTCCGAC
GTCAAGCTCCCGGCGCCCGAGTACACGGCGCAGCAGACGACGGCGTACTACGGGCGGCTGGGGCTGAGCGCGTTCGACACGGTGCTGCTGCTGGGCGCGCACACCGTCGGCGCCACGCGC
TGCAGCGTCATCAAGAGCAGGCTCTACGGGTACGGCGGCCGGCCCGGCGCGACGGACCCCGGCATGGACCCGGCCTACGCGTCCATCTACAAGAAGTACGTGTGCCCCAACATGCCGTCG
TCGGACAACAACGTGGTGTTCCTGGACGACCAGTGGAGCGCGCTCAAGGTGGACAACCACTACTACAAGAACATCCAGCTCCGCCGGGGGGTGCTCCCCTGCGACCAGAACCTGTACAAC
GACGGCTCCACGAGGTGGATCGTGGACCTGCTCGCCAACAACGACGGCCTCTTCACCTCGGCCTTCCCGCAGGCGCTCATCAAGCTCAGCGAGGTCGGCGTGCTCACCGGCATGCAGGGG
GAGATCCGCAAGGTCTGCAACAGGTTCAAC

Retrieve as FASTA