Entry information : SiPrx162 (Si036621m)
Entry ID 9505
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx162 (Si036621m)
Name (synonym) SiPrx162 (Si036621m)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx162
start..stop
S start..stop
PviPrx02 607 0 1..325 1..324
ZmPrx105 601 0 1..325 1..325
ZmPrx142 586 0 1..325 1..326
SbPrx10 582 0 1..325 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 36462815..36463039 225 N° 2 36463135..36463314 180 N° 3 36463588..36463750 163 N° 4 36464487..36464893 407
join(36462815..36463039,36463135..36463314,36463588..36463750,36464487..36464893 )


exon

Literature and cross-references SiPrx162 (Si036621m)
DNA ref. Phytozome 12:   scaffold_9 (36462815..36464893)
Protein sequence: SiPrx162 (Si036621m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (299)
PWM (Da):   %s   34887.45 (32309.1) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.38 (5.87) Peptide Signal:   %s   cut: 27 range:27-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQPARSAALLAAVAVVVLASAASCRGQLANNYYAGKCGNASVETIIQDAVKARLAWDKRMVAGLLHLQFHDCFVDGCDASILLDGPNTEKTAVQNSGIFGYDFIDDVKTALENVCPGVVSCADIIIAATRDAVAMCGGPRYQVQLGRRDGMVSQASRASILPGPNVDIPTAISLFSKKNLNSFDMAILMGAHTVGVTHCSVIHDRLYDFNGTGLPDPGMDPLYVWILTTFACPKGQAFDNIVYLDDPSSILLVDKSYYAQIMKRHGVLAVDQALGDHSSTAWMVNFLATTDFFPSMFSYALNKLAALDVLTGTAGEIRKNCRRTN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCCGGCCCGCTCCGCCGCGCTGCTCGCCGCCGTCGCCGTCGTCGTGCTGGCTTCCGCCGCGAGCTGCCGCGGCCAGCTGGCCAACAACTACTACGCCGGCAAGTGCGGCAATGCC
AGCGTGGAGACCATCATCCAGGACGCCGTCAAGGCCCGCCTCGCCTGGGACAAGCGGATGGTCGCCGGCCTCCTCCACCTGCAGTTCCACGACTGCTTTGTCGAC
GTACGCACACACCAC
TGCATGCTACTCCTTCTTCAATCGTGTCATCATCAGTTTGATTTGATTTGTTGCTGATCTATTCGCGCTGGCTAATGAAGGGGTGCGACGCGTCGATCCTGCTGGACGGGCCCAACACGG
AGAAGACGGCGGTGCAGAACAGCGGCATCTTCGGCTACGACTTCATCGACGACGTCAAGACGGCGCTCGAGAACGTGTGCCCCGGCGTCGTCTCCTGCGCCGACATCATCATCGCCGCAA
CAAGGGACGCCGTTGCCATG
GTGAGTCACCCGGCCCATTGTATGCTAGTGCTACTTGCCGTGAGCAAGCAAAGCTGATTGATTTTCTTTTTTGAGGAACAGCAATGTCGAGTGACGACTT
CATTAATTTGCTTCTTGGCATTTGCCTTTTCTTTTTAATTTGCTCTCTCTTGTCACTCGTTATTGTACATGCGGTTTTGCCAAGAAGCAGATAATTATTGTAATCCTAATTTACCATTAG
GTTATATCACAAATTATCAATGTACTAATCTAGTGTGTTCACAACAAGTCCAGTGCGGAGGGCCTAGGTACCAAGTGCAACTGGGAAGAAGGGACGGCATGGTGTCACAAGCGTCCAGGG
CGAGCATTCTGCCAGGCCCCAACGTCGACATCCCCACCGCCATCAGTCTATTCTCCAAGAAGAACCTCAACAGCTTCGACATGGCCATCCTCATGG
GTACGCTGCCGCCTACGCTACGCT
GCCATTTCTTAAATCTGACGACCTAATTAAGAAATAATGAAATATCACTACCGGTAGTTACTAGCCATTTATACTGCCTGCTGAAAGTTTTACCATGGCCCATGTGTCCTCCTCGACTAC
ATCAAGACTGCGGTTTTACTAAGTTAGCCTCTTTTGACCTAGAACACAGCTAAGCTTATTGACTCAATGTGCATAGATCAAGAGGCTCAACACATGGAATGTCACGTAGATTAGTGTTGG
CATACATAAAGTAACAGTTTAGTATATTATATTTAGATATATGCGTTAATTTATTGAGCTACTTGCAGGTCTTAACGTCATACTAACGTACTAGACATATCATATTTATTACGTTCTTTC
CCCTTCCAATGTACCATCATGATGATCAGCCAGATTTGTATTTATATATGTGCTAAATCAGGTCGATAGAGATCTCAGACTGGCATTGGTAAGTGGGAAGAGTAAGAACTAAGAACCACA
CAAGCTTCCAGGCAGTGTAGGCACAATGCAAAAATAGCTAGCAGTAGTAAAAAAAATATTCGGTGATCCACCTGTTTTTTTCTTGGAGAATTAATAATGCTGTTCTCCACCATAAAGAGT
ACATCTATCTCATATTAGCTAGCTTTCAAATTTATTTCCAGCTACATACTAGATTAGTTAGTGTCGAAAGCTTTTCTTTACAAATCCTGTTTTTCCCTTTTCTTTCTGGCAGGCGCGCAC
ACGGTGGGGGTGACACACTGCTCGGTGATCCACGACCGGCTCTACGACTTCAACGGCACGGGGTTGCCGGACCCGGGCATGGACCCGCTGTACGTCTGGATCCTGACGACGTTCGCGTGC
CCCAAGGGCCAGGCCTTCGACAACATCGTCTACCTCGACGACCCCTCCAGCATCCTCCTCGTCGACAAGAGCTACTACGCGCAGATCATGAAGCGCCACGGCGTTCTCGCCGTCGACCAG
GCACTGGGCGACCACAGCTCCACCGCGTGGATGGTCAACTTCCTGGCCACCACCGACTTCTTCCCCTCCATGTTCAGCTACGCGCTCAACAAGCTCGCCGCGCTCGACGTCCTCACCGGC
ACCGCCGGCGAGATCAGGAAAAACTGCCGGAGGACCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCCGGCCCGCTCCGCCGCGCTGCTCGCCGCCGTCGCCGTCGTCGTGCTGGCTTCCGCCGCGAGCTGCCGCGGCCAGCTGGCCAACAACTACTACGCCGGCAAGTGCGGCAATGCC
AGCGTGGAGACCATCATCCAGGACGCCGTCAAGGCCCGCCTCGCCTGGGACAAGCGGATGGTCGCCGGCCTCCTCCACCTGCAGTTCCACGACTGCTTTGTCGAC
GGGTGCGACGCGTCG
ATCCTGCTGGACGGGCCCAACACGGAGAAGACGGCGGTGCAGAACAGCGGCATCTTCGGCTACGACTTCATCGACGACGTCAAGACGGCGCTCGAGAACGTGTGCCCCGGCGTCGTCTCC
TGCGCCGACATCATCATCGCCGCAACAAGGGACGCCGTTGCCATG
TGCGGAGGGCCTAGGTACCAAGTGCAACTGGGAAGAAGGGACGGCATGGTGTCACAAGCGTCCAGGGCGAGCATT
CTGCCAGGCCCCAACGTCGACATCCCCACCGCCATCAGTCTATTCTCCAAGAAGAACCTCAACAGCTTCGACATGGCCATCCTCATGG
GCGCGCACACGGTGGGGGTGACACACTGCTCG
GTGATCCACGACCGGCTCTACGACTTCAACGGCACGGGGTTGCCGGACCCGGGCATGGACCCGCTGTACGTCTGGATCCTGACGACGTTCGCGTGCCCCAAGGGCCAGGCCTTCGACAAC
ATCGTCTACCTCGACGACCCCTCCAGCATCCTCCTCGTCGACAAGAGCTACTACGCGCAGATCATGAAGCGCCACGGCGTTCTCGCCGTCGACCAGGCACTGGGCGACCACAGCTCCACC
GCGTGGATGGTCAACTTCCTGGCCACCACCGACTTCTTCCCCTCCATGTTCAGCTACGCGCTCAACAAGCTCGCCGCGCTCGACGTCCTCACCGGCACCGCCGGCGAGATCAGGAAAAAC
TGCCGGAGGACCAAC

Retrieve as FASTA