Entry information : SiPrx18 (Si002216m)
Entry ID 9517
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx18 (Si002216m)
Name (synonym) SiPrx18 (Si002216m)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx18
start..stop
S start..stop
SbPrx51 594 0 1..327 1..331
BdiPrx50 586 0 1..327 1..326
TaPrx94-1D 577 0 1..327 1..326
TaPrx94-1A 574 0 1..327 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10222812..10223030 219 N° 2 10223232..10223411 180 N° 3 10223517..10223679 163 N° 4 10223769..10224187 419
join(10222812..10223030,10223232..10223411,10223517..10223679,10223769..10224187 )


exon

Literature and cross-references SiPrx18 (Si002216m)
DNA ref. Phytozome 12:   scaffold_5 (10222812..10224187)
Protein sequence: SiPrx18 (Si002216m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (302)
PWM (Da):   %s   35124.65 (32289.2)  
PI (pH):   %s   6.35 (6.13) Peptide Signal:   %s   cut: 26 range:26-327
Sequence 369
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVASEMAALLFLFTSLLLRGSFVHSQGLQIGFYDSYCPDAEDIVRSTVEQYYDKDATIAPGLLRLHFHDCFVQGCDGSVLISGASSERSAPQNFGLRGFEVIDDAKSQLEAVCPGVVSCADILALAARDAVDLTGGPSWSVPLGRRDGRISLASGAKALPSPADPVSVQRQKFADQGLSDHDLVTLVGAHTIGQTDCQFFSYRLFNFTATGNADPTISPAFLAQLRALCPPNGDPGRRVALDRDSPGAFDVAFFKNVRDGNAVLESDQRLWSDAATQGAVQKYAGNVRGLLGLRFAYEFPKAMVRMSSVAVKTGGQGEIRRRCSRIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGTAGCGTCAGAAATGGCAGCTCTTCTCTTTTTATTCACTTCTCTGCTGCTGAGAGGTTCCTTTGTTCACAGTCAAGGGCTCCAGATCGGATTCTACGACTCTTACTGTCCTGATGCCG
AGGATATTGTGAGGTCTACTGTCGAACAGTACTACGACAAGGATGCCACCATCGCCCCAGGCTTGCTCAGGCTACACTTTCATGACTGCTTCGTTCAA
GTTAGTTATATTCCCTATTTTT
TCTGAGGAACAAGATTATTAGCTCTTAAGGATATTACTCTGAATTCCATGTTTTTGTTACCTTTTTTCCCCTACTAATGCATACTTGACAAGCTGCATAACTAGTTATCTCGAATCTGAA
ATAGTCAAAATTTTAGACTGAATAATTTCAGTCTGACAATTGTGATGCTTACTTGGCAGGGTTGTGATGGATCAGTCTTGATTTCTGGAGCATCTTCTGAACGGAGTGCCCCACAAAATT
TTGGTCTGAGGGGGTTTGAGGTGATAGATGACGCTAAATCCCAGCTGGAAGCTGTGTGCCCTGGCGTAGTGTCTTGTGCTGATATACTGGCTCTTGCCGCACGTGATGCCGTTGATCTG
G
TGAGAACATGTTATACCTTGACAATTCTTCTGTTTTATTAAGGTCAAAATTTTTTACCGTTTTACTGAGATTATGATGAGTGAATTGTTCTTCTGCCATGTAAGACCGGTGGGCCAAGCT
GGTCAGTGCCACTGGGGAGAAGAGACGGCAGAATTTCATTAGCTTCTGGTGCTAAGGCCTTGCCATCTCCTGCCGATCCTGTATCTGTTCAGAGGCAGAAGTTCGCGGATCAAGGCCTGT
CAGACCATGACCTCGTAACATTAGTCG
GTAAATCTTCATCTGTTCATGTCTGAACACGTATTGCAATTCAGTCCAACGAACGATGCTAGCTTGTGTAAACTTGAGCTGTTGAGCAGGTGC
CCACACCATCGGGCAGACGGACTGCCAGTTCTTCAGCTACCGTCTGTTCAACTTCACGGCGACGGGCAACGCGGACCCGACCATCAGCCCGGCGTTCCTGGCGCAGCTCCGGGCGCTGTG
CCCGCCCAACGGCGACCCGGGGCGGCGGGTGGCGCTGGACAGGGACAGCCCCGGCGCGTTCGACGTGGCCTTCTTCAAGAACGTCCGGGACGGCAACGCCGTGCTGGAGTCGGACCAGCG
GCTGTGGAGCGACGCCGCCACGCAGGGCGCCGTGCAGAAGTACGCCGGCAACGTCCGGGGCCTGCTCGGGCTCCGCTTCGCCTACGAGTTCCCTAAGGCCATGGTGCGGATGAGCAGCGT
CGCCGTGAAGACCGGCGGGCAGGGCGAGATCAGGAGGAGGTGCTCCAGGATCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGTAGCGTCAGAAATGGCAGCTCTTCTCTTTTTATTCACTTCTCTGCTGCTGAGAGGTTCCTTTGTTCACAGTCAAGGGCTCCAGATCGGATTCTACGACTCTTACTGTCCTGATGCCG
AGGATATTGTGAGGTCTACTGTCGAACAGTACTACGACAAGGATGCCACCATCGCCCCAGGCTTGCTCAGGCTACACTTTCATGACTGCTTCGTTCAA
GGTTGTGATGGATCAGTCTTGA
TTTCTGGAGCATCTTCTGAACGGAGTGCCCCACAAAATTTTGGTCTGAGGGGGTTTGAGGTGATAGATGACGCTAAATCCCAGCTGGAAGCTGTGTGCCCTGGCGTAGTGTCTTGTGCTG
ATATACTGGCTCTTGCCGCACGTGATGCCGTTGATCTG
ACCGGTGGGCCAAGCTGGTCAGTGCCACTGGGGAGAAGAGACGGCAGAATTTCATTAGCTTCTGGTGCTAAGGCCTTGCCAT
CTCCTGCCGATCCTGTATCTGTTCAGAGGCAGAAGTTCGCGGATCAAGGCCTGTCAGACCATGACCTCGTAACATTAGTCG
GTGCCCACACCATCGGGCAGACGGACTGCCAGTTCTTCA
GCTACCGTCTGTTCAACTTCACGGCGACGGGCAACGCGGACCCGACCATCAGCCCGGCGTTCCTGGCGCAGCTCCGGGCGCTGTGCCCGCCCAACGGCGACCCGGGGCGGCGGGTGGCGC
TGGACAGGGACAGCCCCGGCGCGTTCGACGTGGCCTTCTTCAAGAACGTCCGGGACGGCAACGCCGTGCTGGAGTCGGACCAGCGGCTGTGGAGCGACGCCGCCACGCAGGGCGCCGTGC
AGAAGTACGCCGGCAACGTCCGGGGCCTGCTCGGGCTCCGCTTCGCCTACGAGTTCCCTAAGGCCATGGTGCGGATGAGCAGCGTCGCCGTGAAGACCGGCGGGCAGGGCGAGATCAGGA
GGAGGTGCTCCAGGATCAAC

Retrieve as FASTA