Entry information : SiPrx35 (Si006924m)
Entry ID 9533
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx35 (Si006924m)
Name (synonym) SiPrx35 (Si006924m)
Class Class III peroxidase    [Orthogroup: Prx103]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx35
start..stop
S start..stop
SbPrx142 543 0 1..319 1..318
SiPrx36 523 0 1..319 1..318
SbPrx141 515 0 20..319 21..320
ZmPrx133 513 0 1..319 1..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37025452..37025673 222 N° 2 37025145..37025342 198 N° 3 37024792..37024951 160 N° 4 37024322..37024698 377
complement(join(37024322..37024698,37024792..37024951,37025145..37025342,3702545 2..37025673))


exon

Literature and cross-references SiPrx35 (Si006924m)
DNA ref. Phytozome 12:   scaffold_4 (37025673..37024322)
Protein sequence: SiPrx35 (Si006924m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (292)
PWM (Da):   %s   34386 (31488.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.15 (6.49) Peptide Signal:   %s   cut: 28 range:28-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLRVVVLFVAATVMFVAFVPPPAVAQLRTDYYASVCPNLENIVRNSVRQSMAQSQISAPAALRLFFHDCAVMGCDASIMITNSNGDDEWRNSDNQSLKREGFTTILSAKAAVDSDPQCRNKVSCADILALAARESVLQSGGPYYPVELGRYDGRASTRASVVLPRVNFNLDQLNAFFSGLGFNQTEMVALLGAHTLGAADCPFFQYRIGSDPTMDQGLASQLRGTCGSNPTNGFAFLDPSPVTFDNAFYRNLQGGRGLLGSDQVLYSDTRSRGAVDNYASNQGAFFADFVAAITKLGRVGVKTAANGEIRRDCRFPN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGCCTTCGGGTGGTGGTCTTGTTTGTCGCCGCCACCGTCATGTTCGTGGCGTTCGTGCCGCCGCCCGCCGTCGCGCAGCTGAGGACGGACTACTACGCCAGTGTCTGCCCCAAC
CTCGAGAACATCGTCCGGAACTCCGTCAGGCAGTCCATGGCGCAGTCCCAGATCTCGGCGCCCGCCGCGCTCAGGCTCTTCTTCCACGACTGCGCCGTCATG
GTGCGTAAAATCTTATGT
TTCCAAGCTCCAAATAGCTTACTGAGCTCGATTGCGTGTGTGTGCCATCGTCCAATGATCAATCGAGCGTCTGATGATGCGGATGCTGCAGGGCTGCGACGCGTCGATCATGATCACGAA
CTCGAACGGCGACGACGAGTGGCGAAACAGCGACAACCAGTCGCTGAAGCGGGAGGGGTTCACGACGATCCTGAGCGCCAAGGCCGCCGTGGACAGCGACCCGCAGTGCCGCAACAAGGT
GTCGTGCGCGGACATCCTGGCCCTCGCCGCCAGGGAATCCGTCCTCCAG
GTACCCACAGCTTCCATGCCACTCGGATAGGCACCAGCCACGAGCGGCATCATCACATAACTAACTCTCTG
ATCCATGTACAGCTTCGAGAAACTCCGTTCAAATCTTTTTCAGTTATTACATACATGTAACTAACTTTTTTTGCCAGGATGTAACTACCTAATAACTAACTCTCTGCGTGCACTGATGGC
AGAGTGGCGGGCCGTACTACCCAGTGGAGCTGGGCAGGTACGACGGCCGGGCGTCGACCAGGGCCAGCGTCGTGCTCCCGCGCGTCAACTTCAACCTCGACCAGCTCAACGCCTTCTTCT
CCGGCCTCGGCTTCAACCAGACCGAGATGGTCGCCCTCCTAG
GTAAAATCAAACGACGTCTCAATCGTCTCACTTCCTCTCGCAATCGCCAGCCGACGACTGACCACCAAGACTTACGCC
AATCTTACAATCCAGGAGCCCACACCCTCGGCGCGGCAGACTGCCCCTTCTTCCAGTACCGGATCGGCAGCGACCCGACCATGGACCAGGGCCTGGCGTCGCAGCTGCGCGGCACCTGCG
GCTCCAACCCCACCAACGGCTTCGCGTTCCTGGACCCCTCGCCGGTGACCTTCGACAACGCCTTCTACCGGAACCTGCAGGGCGGCAGGGGCCTCCTGGGCTCCGACCAGGTGCTGTACA
GCGACACGAGGTCCCGCGGCGCCGTCGACAACTACGCGTCCAACCAGGGCGCCTTCTTCGCCGACTTCGTGGCGGCCATCACCAAGCTCGGGAGGGTCGGGGTCAAGACGGCGGCCAACG
GCGAGATACGCCGTGACTGCCGGTTCCCGAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGCCTTCGGGTGGTGGTCTTGTTTGTCGCCGCCACCGTCATGTTCGTGGCGTTCGTGCCGCCGCCCGCCGTCGCGCAGCTGAGGACGGACTACTACGCCAGTGTCTGCCCCAAC
CTCGAGAACATCGTCCGGAACTCCGTCAGGCAGTCCATGGCGCAGTCCCAGATCTCGGCGCCCGCCGCGCTCAGGCTCTTCTTCCACGACTGCGCCGTCATG
GGCTGCGACGCGTCGATC
ATGATCACGAACTCGAACGGCGACGACGAGTGGCGAAACAGCGACAACCAGTCGCTGAAGCGGGAGGGGTTCACGACGATCCTGAGCGCCAAGGCCGCCGTGGACAGCGACCCGCAGTGC
CGCAACAAGGTGTCGTGCGCGGACATCCTGGCCCTCGCCGCCAGGGAATCCGTCCTCCAG
AGTGGCGGGCCGTACTACCCAGTGGAGCTGGGCAGGTACGACGGCCGGGCGTCGACCAGG
GCCAGCGTCGTGCTCCCGCGCGTCAACTTCAACCTCGACCAGCTCAACGCCTTCTTCTCCGGCCTCGGCTTCAACCAGACCGAGATGGTCGCCCTCCTAG
GAGCCCACACCCTCGGCGCG
GCAGACTGCCCCTTCTTCCAGTACCGGATCGGCAGCGACCCGACCATGGACCAGGGCCTGGCGTCGCAGCTGCGCGGCACCTGCGGCTCCAACCCCACCAACGGCTTCGCGTTCCTGGAC
CCCTCGCCGGTGACCTTCGACAACGCCTTCTACCGGAACCTGCAGGGCGGCAGGGGCCTCCTGGGCTCCGACCAGGTGCTGTACAGCGACACGAGGTCCCGCGGCGCCGTCGACAACTAC
GCGTCCAACCAGGGCGCCTTCTTCGCCGACTTCGTGGCGGCCATCACCAAGCTCGGGAGGGTCGGGGTCAAGACGGCGGCCAACGGCGAGATACGCCGTGACTGCCGGTTCCCGAAC

Retrieve as FASTA