Entry information : SiPrx36 (Si006929m)
Entry ID 9534
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx36 (Si006929m)
Name (synonym) SiPrx36 (Si006929m)
Class Class III peroxidase    [Orthogroup: Prx112]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx36
start..stop
S start..stop
SbPrx141 550 0 1..318 1..320
ZmPrx133 536 0 1..318 1..320
SiPrx35 533 0 1..318 1..319
SbPrx142 513 0 1..318 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37034920..37035138 219 N° 2 37034621..37034818 198 N° 3 37034325..37034484 160 N° 4 37033825..37034201 377
complement(join(37033825..37034201,37034325..37034484,37034621..37034818,3703492 0..37035138))


exon

Literature and cross-references SiPrx36 (Si006929m)
DNA ref. Phytozome 12:   scaffold_4 (37035138..37033825)
Protein sequence: SiPrx36 (Si006929m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (292)
PWM (Da):   %s   34183.74 (31541.3)  
PI (pH):   %s   6.26 (5.74) Peptide Signal:   %s   cut: 27 range:27-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLRLGFFVAAAVVSAALMPPSAVAQLRPYYYSSICPNLEVIVRSSVQQSMAQSPISAPAALRLFFHDCAVRGCDASIMIVNSNGDDEWRNPDNQSLKPEGFQVILNAKAAVDSDPRCQYKVSCADIMALAARESISQSGGPYYEVELGRYDGRVSTKASVVLPHANFNLDQLNSYFSGLGLSQSEMIALSGGHTLGAADCPFFQYRIGTDPTMDPNFASQLNATCSSNPTNGFAFLDPSPVTFDNAFFRNLQGGKGLLGSDQVLYSDTRSRGTVNYYASNQGAFFGDFVAAITKLGRVGVKTAATGEIRRDCRFPN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGCCTTCGGTTGGGCTTCTTTGTCGCCGCCGCCGTCGTGTCCGCGGCGCTCATGCCGCCGTCTGCCGTCGCGCAGCTGAGGCCGTACTACTACTCCAGCATCTGCCCCAACCTG
GAGGTCATCGTCCGGAGCTCCGTCCAGCAGTCCATGGCGCAGTCCCCGATCTCCGCACCCGCCGCGCTCAGGCTCTTCTTCCACGACTGCGCCGTCAGG
GTGCGTAGCGTATGCTTATCA
CGCAGTGTGCCCATCAAACCAGCTCGCGCCTTTGTAGCACCCAGTGATCCATTCAACTGTCTCTGTTGATGCGCGTGCAGGGGTGTGACGCGTCGATCATGATCGTGAACTCGAACGGCG
ACGACGAGTGGCGCAACCCCGACAACCAGTCGCTGAAGCCGGAGGGGTTCCAGGTGATCCTCAACGCCAAGGCCGCCGTGGACAGCGACCCGCGGTGCCAGTACAAGGTCTCCTGCGCGG
ACATCATGGCCCTCGCCGCCAGGGAATCCATCTCCCAG
GTAACTGCCGAGCCGAGCACACATCCACTCATCACCACCAGCTTCTGGATACAGTTACACGTTGTCAGATACATGTAAATAA
TACTCCGTACTACTAACTCTGCACACGCATGGATTCGCATTGTATTGGTCGCAGAGCGGCGGGCCGTACTATGAGGTGGAGCTGGGCCGGTACGACGGCAGGGTGTCGACCAAGGCCAGC
GTCGTGCTGCCTCACGCCAACTTCAACCTCGACCAGCTCAACTCCTACTTCTCCGGCCTCGGCCTCTCCCAGTCTGAAATGATCGCCCTTTCAG
GTAAACGCCTGCTCATACTCACCAGC
TCAATCACTTTCCATTCACTCCGCTTGCGATACACGTCGTCGCGTCGCCATCCATGCCAGCCTGACCATGAAGTATCTTTCTTGTGCGTGAATTCAGGCGGCCACACCCTCGGCGCCGCG
GACTGCCCCTTCTTCCAGTACCGGATCGGCACCGACCCGACCATGGACCCCAACTTCGCGTCGCAGCTGAATGCCACCTGCAGCTCCAACCCCACCAATGGCTTCGCCTTCCTGGACCCC
TCGCCGGTGACCTTCGACAACGCCTTCTTCCGGAACCTGCAGGGCGGCAAGGGGCTCCTGGGCTCCGACCAGGTGCTCTACTCCGACACCCGGTCCCGCGGCACCGTCAACTACTACGCG
TCCAACCAGGGCGCCTTCTTCGGCGACTTCGTGGCGGCCATCACCAAGCTCGGCAGGGTCGGCGTCAAGACGGCGGCCACCGGCGAGATACGCCGCGACTGCCGGTTCCCGAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGCCTTCGGTTGGGCTTCTTTGTCGCCGCCGCCGTCGTGTCCGCGGCGCTCATGCCGCCGTCTGCCGTCGCGCAGCTGAGGCCGTACTACTACTCCAGCATCTGCCCCAACCTG
GAGGTCATCGTCCGGAGCTCCGTCCAGCAGTCCATGGCGCAGTCCCCGATCTCCGCACCCGCCGCGCTCAGGCTCTTCTTCCACGACTGCGCCGTCAGG
GGGTGTGACGCGTCGATCATG
ATCGTGAACTCGAACGGCGACGACGAGTGGCGCAACCCCGACAACCAGTCGCTGAAGCCGGAGGGGTTCCAGGTGATCCTCAACGCCAAGGCCGCCGTGGACAGCGACCCGCGGTGCCAG
TACAAGGTCTCCTGCGCGGACATCATGGCCCTCGCCGCCAGGGAATCCATCTCCCAG
AGCGGCGGGCCGTACTATGAGGTGGAGCTGGGCCGGTACGACGGCAGGGTGTCGACCAAGGCC
AGCGTCGTGCTGCCTCACGCCAACTTCAACCTCGACCAGCTCAACTCCTACTTCTCCGGCCTCGGCCTCTCCCAGTCTGAAATGATCGCCCTTTCAG
GCGGCCACACCCTCGGCGCCGCG
GACTGCCCCTTCTTCCAGTACCGGATCGGCACCGACCCGACCATGGACCCCAACTTCGCGTCGCAGCTGAATGCCACCTGCAGCTCCAACCCCACCAATGGCTTCGCCTTCCTGGACCCC
TCGCCGGTGACCTTCGACAACGCCTTCTTCCGGAACCTGCAGGGCGGCAAGGGGCTCCTGGGCTCCGACCAGGTGCTCTACTCCGACACCCGGTCCCGCGGCACCGTCAACTACTACGCG
TCCAACCAGGGCGCCTTCTTCGGCGACTTCGTGGCGGCCATCACCAAGCTCGGCAGGGTCGGCGTCAAGACGGCGGCCACCGGCGAGATACGCCGCGACTGCCGGTTCCCGAAC

Retrieve as FASTA