Entry information : SiPrx70 (Si017097m)
Entry ID 9561
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-12 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-07 (Qiang Li)
Peroxidase information: SiPrx70 (Si017097m)
Name (synonym) SiPrx70 (Si017097m)
Class Class III peroxidase    [Orthogroup: Prx345]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx70
start..stop
S start..stop
OsPrx25 417 5e-147 31..353 4..338
BdiPrx98 417 6e-147 31..353 4..334
SbPrx73 418 8e-147 50..353 64..377
OsPrx87 416 1e-146 57..353 32..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1996759..1996768 10 N° 2 1995949..1996688 740 N° 3 1995637..1995882 246  
complement(join(1995637..1995882,1995949..1996688,1996759..1996768))


exon

Literature and cross-references SiPrx70 (Si017097m)
DNA ref. Phytozome 12:   scaffold_1 (1996768..1995637)
Protein sequence: SiPrx70 (Si017097m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   354
PWM (Da):   %s   36214.37  
PI (pH):   %s   8.56
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNALRSFLSHTATSIDHPSKKVVQLIECSTMVASSRVLLVLDLALLAAVSCLAGTAAALSTEYYNKRCPSLQPTVRSAVARAVAADPNAGAAVLRLFFHDCFVNGCDASVLLDDGTAPGEKGAGPNANSLRGYEVIDAAKSAVEAACPGAVSCADVLAIAARDAVSLLGGPSWNVRMGRRDARSASRDAANANLPGPGSGLPALVAAFKAKGLSARDMTALSGAHTVGRARCAEFRGRVNANAGEAINATFAAGLRGACPAAGGADGALAPLDPVTPDAFDNGYFRALVERRGLLHSDQELFNGGSQDALVRKYASNGAAFFSDFAKAMVRMGNLAPAPGTPLEVRINCRRPN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Extra 5' end has been removed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATGCCCGTCAGGCCATCACATTAAGCCCAACACTACAAATACCAGCACTCCAGCGCCACCTTTGCCGCCACTTCAGTTCGTTCATTCCTCTCGCACACTGCCACCTCCATCGATCA
CCCAAGCAAGAAGGTTGTTCAGCTGATCGAGTGCTCAACCATGGTCGCTTCGTCCAGGGTCCTCCTCGTGCTCGACCTCGCCCTCCTGGCCGCCGTCTCGTGCCTCGCCGGCACGGCCGC
GGCGCTGTCGACCGAGTACTACAACAAGCGCTGTCCGTCCCTGCAGCCGACGGTGCGGTCCGCGGTGGCGCGCGCCGTGGCGGCAGACCCGAACGCGGGCGCCGCCGTGCTCCGCCTCTT
CTTCCATGACTGCTTCGTCAACGGCTGCGACGCCTCCGTGCTCCTCGACGACGGCACCGCACCCGGCGAGAAGGGCGCGGGACCCAACGCCAACTCCCTCCGCGGCTACGAGGTCATCGA
CGCCGCCAAGTCCGCCGTCGAGGCCGCCTGCCCTGGCGCCGTCTCCTGCGCGGACGTCCTCGCGATAGCCGCCCGCGACGCCGTGTCGCTCCTGGGCGGCCCCTCGTGGAACGTGCGGAT
GGGCCGCCGGGACGCGCGATCCGCCAGCCGCGACGCCGCCAACGCGAACCTCCCCGGTCCGGGGTCCGGCCTGCCCGCCCTCGTCGCCGCGTTCAAGGCCAAGGGCCTCTCGGCGCGCGA
CATGACGGCGCTGTCGGGCGCGCACACCGTCGGCCGGGCGCGCTGCGCCGAGTTCCGCGGCCGCGTCAACGCGAACGCCGGCGAGGCGATCAACGCCACG
TTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGACCCGGTGACTCCCGACGCGTTCGACAACGGCTACTTCCGGGCCCTGGTGGAGCGCCGCGGCCTGCTGCACTC
GGACCAGGAGCTCTTCAACGGCGGGTCGCAGGACGCGCTGGTGAGGAAGTACGCCAGCAACGGCGCCGCGTTCTTCAGCGACTTCGCCAAGGCGATGGTGAGGATGGGCAACCTCGCGCC
GGCGCCCGGGACGCCGCTCGAGGTCAGGATCAACTGCCGGAGGCCCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATGCCCTTCGTTCATTCCTCTCGCACACTGCCACCTCCATCGATCACCCAAGCAAGAAGGTTGTTCAGCTGATCGAGTGCTCAACCATGGTCGCTTCGTCCAGGGTCCTCCTCGTG
CTCGACCTCGCCCTCCTGGCCGCCGTCTCGTGCCTCGCCGGCACGGCCGCGGCGCTGTCGACCGAGTACTACAACAAGCGCTGTCCGTCCCTGCAGCCGACGGTGCGGTCCGCGGTGGCG
CGCGCCGTGGCGGCAGACCCGAACGCGGGCGCCGCCGTGCTCCGCCTCTTCTTCCATGACTGCTTCGTCAACGGCTGCGACGCCTCCGTGCTCCTCGACGACGGCACCGCACCCGGCGAG
AAGGGCGCGGGACCCAACGCCAACTCCCTCCGCGGCTACGAGGTCATCGACGCCGCCAAGTCCGCCGTCGAGGCCGCCTGCCCTGGCGCCGTCTCCTGCGCGGACGTCCTCGCGATAGCC
GCCCGCGACGCCGTGTCGCTCCTGGGCGGCCCCTCGTGGAACGTGCGGATGGGCCGCCGGGACGCGCGATCCGCCAGCCGCGACGCCGCCAACGCGAACCTCCCCGGTCCGGGGTCCGGC
CTGCCCGCCCTCGTCGCCGCGTTCAAGGCCAAGGGCCTCTCGGCGCGCGACATGACGGCGCTGTCGGGCGCGCACACCGTCGGCCGGGCGCGCTGCGCCGAGTTCCGCGGCCGCGTCAAC
GCGAACGCCGGCGAGGCGATCAACGCCACG
GACCCGGTGACTCCCGACGCGTTCGACAACGGCTACTTCCGGGCCCTGGTGGAGCGCCGCGGCCTGCTGCACTCGGACCAGGAGCTCTTC
AACGGCGGGTCGCAGGACGCGCTGGTGAGGAAGTACGCCAGCAACGGCGCCGCGTTCTTCAGCGACTTCGCCAAGGCGATGGTGAGGATGGGCAACCTCGCGCCGGCGCCCGGGACGCCG
CTCGAGGTCAGGATCAACTGCCGGAGGCCCAACTAG

Retrieve as FASTA