Entry information : SiPrx73 (Si017708m)
Entry ID 9564
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx73 (Si017708m)
Name (synonym) SiPrx73 (Si017708m)
Class Class III peroxidase    [Orthogroup: Prx063]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx73
start..stop
S start..stop
PviPrx01 566 0 1..341 1..344
ZmPrx96 525 0 1..340 1..342
SbPrx79 502 1e-180 17..338 21..347
TaPrx99-1B 382 2e-133 17..342 19..340
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 24335954..24336148 195 N° 2 24336259..24337089 831  
join(24335954..24336148,24336259..24337089)


exon

Literature and cross-references SiPrx73 (Si017708m)
DNA ref. Phytozome 12:   scaffold_1 (24335954..24337089)
Protein sequence: SiPrx73 (Si017708m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343 (318)
PWM (Da):   %s   36685.6 (34207.3)  
PI (pH):   %s   6.91 (6.52) Peptide Signal:   %s   cut: 25 range:25-342
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKLSAAVLSLCVVLAFLAGQSAAGRYYSDKVQDKVRKEVEKAMAYNPGLGAALVRLVFHDCWINGCDGSVLLDKTPTDGTNTEKKAVTNIGLAGFEVIDTIKQKVGANTSCADILVFAGRDAADILSGGKIFYKLDGGLKDGVVSSAAAADANLPESTFDFTDLQNNFAASGRGFTVKELVALSGAHSIGVAHLSSYQDRLAADATPIDSDYQLALNKTTPLELLKKGQNPTVPNNPRDASAAFQKDAAYDPVTLGVSPTRNVLDNSYYHNNLENKVLFKSDWVLRTDGVAAGKLQDYKDNAAMWNSDFAAAMAKLSGLPPQGKNLEIRKNCRFTNQQYYY*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGCTCAGCGCCGCCGTGCTATCTCTGTGCGTGGTTCTCGCCTTCCTCGCCGGGCAGTCGGCCGCCGGCCGGTACTACTCGGACAAAGTCCAGGACAAGGTGAGGAAGGAAGTG
GAGAAGGCCATGGCGTACAACCCCGGCCTCGGCGCCGCCCTCGTCCGCTTGGTGTTCCATGACTGCTGGATCAAT
GTGAGTAGCCACGATTACTCTCTTCTCTTTCTCATCATCACGCGC
GCGCGTACATGGCTTCGTTTGGGACATGACATTGATGGATATATACCTTTTCATCATTATTCTAGGGTTGTGATGGATCCGTGCTCCTCGACAAGACGCCAACCGACGGCACCAACACCG
AGAAGAAGGCGGTCACCAACATCGGCCTCGCCGGCTTCGAGGTCATCGACACCATCAAGCAGAAGGTCGGCGCCAACACCTCCTGCGCCGACATCCTCGTCTTCGCGGGGCGCGACGCCG
CGGACATCCTCAGCGGCGGCAAGATCTTCTACAAGCTCGACGGCGGCCTCAAGGACGGCGTCGTCTCGTCCGCCGCGGCCGCGGACGCCAACCTCCCCGAGTCCACCTTCGACTTCACCG
ATCTGCAGAACAACTTCGCCGCGTCCGGCCGCGGGTTCACCGTCAAGGAGCTCGTCGCGCTCTCCGGCGCGCACTCCATCGGCGTCGCGCACCTCTCGTCCTACCAGGACCGTCTCGCCG
CCGACGCCACGCCCATCGACTCCGACTACCAGTTGGCGCTGAACAAGACGACGCCCCTGGAGTTGCTCAAGAAGGGGCAGAACCCGACGGTGCCCAACAACCCCCGCGACGCGAGCGCCG
CGTTCCAGAAGGACGCCGCCTACGACCCCGTGACGCTGGGGGTGAGCCCGACCAGGAACGTCCTGGACAACAGCTACTACCACAACAACCTCGAGAACAAGGTGCTATTCAAGTCCGACT
GGGTGCTGCGCACGGACGGCGTCGCCGCCGGCAAGCTGCAGGATTACAAGGACAACGCGGCGATGTGGAACTCCGACTTCGCCGCCGCCATGGCCAAGCTCAGCGGCCTTCCCCCCCAGG
GCAAGAATTTGGAGATCAGGAAGAACTGCAGGTTCACCAACCAGCAGTACTACTAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGCTCAGCGCCGCCGTGCTATCTCTGTGCGTGGTTCTCGCCTTCCTCGCCGGGCAGTCGGCCGCCGGCCGGTACTACTCGGACAAAGTCCAGGACAAGGTGAGGAAGGAAGTG
GAGAAGGCCATGGCGTACAACCCCGGCCTCGGCGCCGCCCTCGTCCGCTTGGTGTTCCATGACTGCTGGATCAAT
GGTTGTGATGGATCCGTGCTCCTCGACAAGACGCCAACCGACGGC
ACCAACACCGAGAAGAAGGCGGTCACCAACATCGGCCTCGCCGGCTTCGAGGTCATCGACACCATCAAGCAGAAGGTCGGCGCCAACACCTCCTGCGCCGACATCCTCGTCTTCGCGGGG
CGCGACGCCGCGGACATCCTCAGCGGCGGCAAGATCTTCTACAAGCTCGACGGCGGCCTCAAGGACGGCGTCGTCTCGTCCGCCGCGGCCGCGGACGCCAACCTCCCCGAGTCCACCTTC
GACTTCACCGATCTGCAGAACAACTTCGCCGCGTCCGGCCGCGGGTTCACCGTCAAGGAGCTCGTCGCGCTCTCCGGCGCGCACTCCATCGGCGTCGCGCACCTCTCGTCCTACCAGGAC
CGTCTCGCCGCCGACGCCACGCCCATCGACTCCGACTACCAGTTGGCGCTGAACAAGACGACGCCCCTGGAGTTGCTCAAGAAGGGGCAGAACCCGACGGTGCCCAACAACCCCCGCGAC
GCGAGCGCCGCGTTCCAGAAGGACGCCGCCTACGACCCCGTGACGCTGGGGGTGAGCCCGACCAGGAACGTCCTGGACAACAGCTACTACCACAACAACCTCGAGAACAAGGTGCTATTC
AAGTCCGACTGGGTGCTGCGCACGGACGGCGTCGCCGCCGGCAAGCTGCAGGATTACAAGGACAACGCGGCGATGTGGAACTCCGACTTCGCCGCCGCCATGGCCAAGCTCAGCGGCCTT
CCCCCCCAGGGCAAGAATTTGGAGATCAGGAAGAACTGCAGGTTCACCAACCAGCAGTACTACTAC

Retrieve as FASTA