Entry information : SiPrx79 ( Si017824m)
Entry ID 9570
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-15 (Christophe Dunand)
Peroxidase information: SiPrx79 ( Si017824m)
Name (synonym) SiPrx79 ( Si017824m)
Class Class III peroxidase    [Orthogroup: Prx236]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx79
start..stop
S start..stop
ZmPrx122 392 7e-138 1..316 1..314
SbPrx76 334 4e-115 2..316 6..319
SbPrx77 302 1e-102 1..316 1..322
SiPrx80 290 1e-97 1..316 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1966999..1967232 234 N° 2 1966708..1966920 213 N° 3 1966087..1966593 507  
complement(join(1966087..1966593,1966708..1966920,1966999..1967232))


exon

Literature and cross-references SiPrx79 ( Si017824m)
DNA ref. Phytozome 12:   scaffold_1 (1967232..1966087)
Cluster/Prediction ref. Genebank:   101768840
Protein sequence: SiPrx79 ( Si017824m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (294)
PWM (Da):   %s   34487.36 (32152.2)  
PI (pH):   %s   6.77 (6.66) Peptide Signal:   %s   cut: 25 range:25-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSTAGGHCFLLALLLLSSAAYGQLSENFYAATNCSNLDEIVKREVSRTLFTVPPPDGGRRMGASLLRLFFHDSFVQGCDASVLLDINTDVRKGRIILSSEKQASPNFNSLRGFDVIDRIKDEVERNCPGVVSCADILALAARAAVVALEGPTWPLLLGRRDSTTANMTEANNALPGPNSNLDELIGKFHNKSFNARELVALSGAHTIGQAQCQFADPKQQKARCPNGVVGKTASLDVHTPEVFDNRYYGNLTKDGLLHSDQVLTSRDDVKAFVEEYKSNQDTFFRDFASAMKRMSELGVLTGTNGQIRTDCSRVLN

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). Incorrect prediction from phytozome (Very short sequence after HTIG is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGTCCACCGCCGGCGGCCATTGCTTCCTTCTTGCTCTTCTCCTTCTCTCCTCCGCCGCCTATGGGCAGCTCTCGGAGAACTTCTACGCCGCCACAAATTGCTCGAACTTGGAT
GAAATCGTTAAAAGGGAGGTGTCTCGTACCTTGTTCACCGTCCCACCACCCGACGGCGGTCGCCGGATGGGCGCCTCCCTCCTCCGGCTCTTCTTCCACGACAGCTTCGTTCAG
GTATAT
ACCGTGCGCGATCCTGAAAACCACTCAAGGTATCATATATGACATTCACTTATTTGGTTGTGAATAATGTAGGGCTGCGACGCCTCTGTTCTTCTGGACATCAACACGGACGTGAGAAAG
GGAAGAATAATATTGTCGAGCGAGAAGCAAGCCAGCCCCAACTTCAACTCCCTACGCGGTTTCGATGTCATCGACCGGATCAAGGACGAGGTCGAGAGGAATTGCCCCGGCGTCGTCTCC
TGCGCCGACATCCTCGCCCTCGCCGCGCGGGCAGCCGTCGTCGCC
GTAAGAGCTTAACATGACATATACCTACCATGCAAAAACGTGTAGTTACTTTATATGTAGTTGCTTATATTAACA
CATCCATGCATATTTCAATCGTCGTTGCGGCGTTTGCAGCTCGAGGGACCAACCTGGCCGCTGTTGCTCGGCCGTCGCGACTCGACGACGGCGAACATGACCGAAGCGAACAACGCCCTC
CCGGGGCCGAACTCCAACCTCGACGAGCTCATCGGTAAGTTCCACAACAAGAGCTTCAACGCGCGCGAGCTGGTGGCGCTCTCCGGCGCGCACACCATCGGCCAGGCACAATGCCAATTC
GCCGACCCAAAGCAGCAGAAAGCAAGATGCCCGAACGGCGTCGTCGGCAAGACGGCGTCGCTCGACGTGCATACGCCTGAGGTCTTCGACAACCGCTACTACGGCAACCTGACAAAGGAC
GGCCTGCTGCACTCCGACCAGGTGCTCACGAGCCGCGATGACGTGAAGGCGTTCGTGGAGGAGTACAAATCCAACCAGGACACCTTCTTCCGCGACTTCGCGAGCGCGATGAAGAGGATG
TCGGAGTTGGGCGTCCTCACCGGAACGAACGGTCAGATCAGGACCGACTGCAGTAGGGTGCTCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGTCCACCGCCGGCGGCCATTGCTTCCTTCTTGCTCTTCTCCTTCTCTCCTCCGCCGCCTATGGGCAGCTCTCGGAGAACTTCTACGCCGCCACAAATTGCTCGAACTTGGAT
GAAATCGTTAAAAGGGAGGTGTCTCGTACCTTGTTCACCGTCCCACCACCCGACGGCGGTCGCCGGATGGGCGCCTCCCTCCTCCGGCTCTTCTTCCACGACAGCTTCGTTCAG
GGCTGC
GACGCCTCTGTTCTTCTGGACATCAACACGGACGTGAGAAAGGGAAGAATAATATTGTCGAGCGAGAAGCAAGCCAGCCCCAACTTCAACTCCCTACGCGGTTTCGATGTCATCGACCGG
ATCAAGGACGAGGTCGAGAGGAATTGCCCCGGCGTCGTCTCCTGCGCCGACATCCTCGCCCTCGCCGCGCGGGCAGCCGTCGTCGCC
CTCGAGGGACCAACCTGGCCGCTGTTGCTCGGC
CGTCGCGACTCGACGACGGCGAACATGACCGAAGCGAACAACGCCCTCCCGGGGCCGAACTCCAACCTCGACGAGCTCATCGGTAAGTTCCACAACAAGAGCTTCAACGCGCGCGAGCTG
GTGGCGCTCTCCGGCGCGCACACCATCGGCCAGGCACAATGCCAATTCGCCGACCCAAAGCAGCAGAAAGCAAGATGCCCGAACGGCGTCGTCGGCAAGACGGCGTCGCTCGACGTGCAT
ACGCCTGAGGTCTTCGACAACCGCTACTACGGCAACCTGACAAAGGACGGCCTGCTGCACTCCGACCAGGTGCTCACGAGCCGCGATGACGTGAAGGCGTTCGTGGAGGAGTACAAATCC
AACCAGGACACCTTCTTCCGCGACTTCGCGAGCGCGATGAAGAGGATGTCGGAGTTGGGCGTCCTCACCGGAACGAACGGTCAGATCAGGACCGACTGCAGTAGGGTGCTCAAC

Retrieve as FASTA