Entry information : TvLiP12 (LiP12)
Entry ID 9593
Creation 2011-10-05 (Christophe Dunand)
Last sequence changes 2012-03-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-10-05 (Christophe Dunand)
Peroxidase information: TvLiP12 (LiP12)
Name (synonym) TvLiP12 (LiP12)
Class Lignin peroxidase    [Orthogroup: LiP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvLiP12
start..stop
S start..stop
TvLiP12_PRL572 754 0 1..372 1..372
TvLiP08 677 0 1..364 1..364
TvLiP04 627 0 1..364 1..364
TvLiP06 625 0 1..359 1..359
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2756035..2756095 61 N° 2 2756169..2756376 208 N° 3 2756434..2756568 135 N° 4 2756622..2757168 547
N° 5 2757234..2757308 75 N° 6 2757365..2757429 65 N° 7 2757486..2757513 28  
join(2756035..2756095,2756169..2756376,2756434..2756568,2756622..2757168,2757234 ..2757308,2757365..2757429,2757486..2757513)


exon

Literature and cross-references TvLiP12 (LiP12)
DNA ref. JGI genome:   scaffold_2 (2756035..2757513)
Protein sequence: TvLiP12 (LiP12)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   372
PWM (Da):   %s   39472.47  
PI (pH):   %s   4.28
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKSLLSFVSVIGALQGANAALTRRVACPDGVNTATNAACCQLFAVREDLQQNLFHGGLCTAEAHESLRLTFHDAIAISPALEAQGIFGGGGADGSIAIFPEIETNFHPNIGLDEIIELQKPFIARHNISVADFIQFAGAIGASNCAGAPQLAAFVGRKDATQPAPDGLVPEPFHTPDQIFDRLADASQGEFDPILTVWLLTAHTVAAANDVDPTKSGLPFDSTPELWDTQFFLETQLRGTSFPGSGGNQGEVESPLAGEMRLQSDHTIARDSRTACEWQSFVDNQPKAQQMFQFVFHDLSIFGQDINTLVDCTEVPIPADPQGHTHFPAGLSNADIEQACAETPFPTFPTDPGPKTAVAPVPKPPAARK

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAGTCTCTTCTTTCTTTCGTCTCGGTCATTGGAGCGCTCCAGGGCGCGAACGGTGCGTAGGAGGTGGCGGGTCTCCGCCGACAGTGCGCCTTTTTGCAGCGTGCTGACACA
CATTAATCATCTAGCCGCGTTGACCCGCCGCGTCGCTTGCCCCGACGGCGTGAACACCGCTACCAACGCGGCGTGCTGCCAGCTCTTCGCCGTCCGCGAGGATCTCCAGCAGAACTTGTT
CCACGGCGGTCTCTGCACGGCTGAGGCGCACGAGTCTCTCCGCCTGACGTTCCACGACGCCATCGCCATCTCCCCCGCTCTCGAGGCCCAGGGCATCTTCGG
GTACGCCGAATGAATTTC
TGCCCCTGGCTCAATTTATTAACAGGATCTGCTATTTAGTGGCGGTGGTGCCGACGGCTCCATCGCGATCTTCCCCGAGATCGAGACCAACTTCCACCCCAACATCGGTCTCGACGAGAT
CATCGAGCTCCAGAAGCCGTTCATCGCCCGTCACAACATCTCCGTCGCTGACTT
GTGAGTACCGGAAGCGAAGCGACGATCGACCTTGTGCTGATTTGTCGGTGCAGCATCCAATTCGCC
GGTGCTATTGGTGCCTCGAACTGCGCGGGTGCCCCCCAGCTCGCCGCCTTCGTTGGCCGCAAGGACGCCACCCAGCCCGCCCCCGACGGCCTCGTCCCCGAGCCGTTCCACACCCCCGAC
CAGATCTTCGACCGTCTCGCCGACGCGTCCCAGGGCGAGTTCGACCCCATCCTCACGGTCTGGCTCCTGACCGCGCACACCGTTGCTGCCGCCAACGACGTCGACCCGACCAAGTCCGGC
CTGCCGTTCGACTCCACCCCCGAGCTCTGGGACACGCAGTTCTTCCTTGAGACCCAGCTCCGCGGCACGAGCTTCCCCGGCTCTGGCGGCAACCAGGGCGAGGTCGAGTCTCCCCTTGCG
GGCGAGATGCGTCTCCAGTCCGACCACACCATCGCTCGCGACTCCCGTACGGCGTGCGAGTGGCAGTCGTTCGTCGACAACCAGCCCAAGGCTCAGCAGATGTTCCAGTTCGTGTTCCAC
GACCTCTCCATCTTCGGCCAGGACATCAACACGCTCGTCGACTGCACGGAAGTC
GTACGTCGCACCATTCTTTCGCATTCTTGGCCCCCTGTAACAGCCACTAACTGCCACATGTATAGG
TCCCCATCCCGGCTGACCCTCAGGGCCACACGCACTTCCCCGCTGGCCTGAGCAACGCCGACATCGAGCAGGCT
GTGAGCACAATCTAGTTCCTCGCCGACTACACTTCACTGACCCATT
CGCCCTATAGTGCGCCGAGACACCCTTCCCAACCTTCCCCACCGACCCCGGACCCAAGACCGCCGTTGCCCCCGTGTAAGTTTCACAACCGATATCACTTGTCTCCACGATTTAACGAGC
CCTTCCACTAGCCCCAAACCCCCTGCCGCCCGGAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAGTCTCTTCTTTCTTTCGTCTCGGTCATTGGAGCGCTCCAGGGCGCGAACGCCGCGTTGACCCGCCGCGTCGCTTGCCCCGACGGCGTGAACACCGCTACCAACGCGGCG
TGCTGCCAGCTCTTCGCCGTCCGCGAGGATCTCCAGCAGAACTTGTTCCACGGCGGTCTCTGCACGGCTGAGGCGCACGAGTCTCTCCGCCTGACGTTCCACGACGCCATCGCCATCTCC
CCCGCTCTCGAGGCCCAGGGCATCTTCGG
TGGCGGTGGTGCCGACGGCTCCATCGCGATCTTCCCCGAGATCGAGACCAACTTCCACCCCAACATCGGTCTCGACGAGATCATCGAGCTC
CAGAAGCCGTTCATCGCCCGTCACAACATCTCCGTCGCTGACTT
CATCCAATTCGCCGGTGCTATTGGTGCCTCGAACTGCGCGGGTGCCCCCCAGCTCGCCGCCTTCGTTGGCCGCAAG
GACGCCACCCAGCCCGCCCCCGACGGCCTCGTCCCCGAGCCGTTCCACACCCCCGACCAGATCTTCGACCGTCTCGCCGACGCGTCCCAGGGCGAGTTCGACCCCATCCTCACGGTCTGG
CTCCTGACCGCGCACACCGTTGCTGCCGCCAACGACGTCGACCCGACCAAGTCCGGCCTGCCGTTCGACTCCACCCCCGAGCTCTGGGACACGCAGTTCTTCCTTGAGACCCAGCTCCGC
GGCACGAGCTTCCCCGGCTCTGGCGGCAACCAGGGCGAGGTCGAGTCTCCCCTTGCGGGCGAGATGCGTCTCCAGTCCGACCACACCATCGCTCGCGACTCCCGTACGGCGTGCGAGTGG
CAGTCGTTCGTCGACAACCAGCCCAAGGCTCAGCAGATGTTCCAGTTCGTGTTCCACGACCTCTCCATCTTCGGCCAGGACATCAACACGCTCGTCGACTGCACGGAAGTC
GTCCCCATC
CCGGCTGACCCTCAGGGCCACACGCACTTCCCCGCTGGCCTGAGCAACGCCGACATCGAGCAGGCT
TGCGCCGAGACACCCTTCCCAACCTTCCCCACCGACCCCGGACCCAAGACCGCC
GTTGCCCCCGT
CCCCAAACCCCCTGCCGCCCGGAAGTAA

Retrieve as FASTA