Entry information : TvLiP08 (LiP8)
Entry ID 9594
Creation 2011-10-05 (Christophe Dunand)
Last sequence changes 2011-10-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-27 (Catherine Mathe (Scipio))
Peroxidase information: TvLiP08 (LiP8)
Name (synonym) TvLiP08 (LiP8)
Class Lignin peroxidase    [Orthogroup: LiP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvLiP08
start..stop
S start..stop
TvLiP12_PRL572 693 0 1..364 1..364
TvLiP12 693 0 1..364 1..364
TvLiP04 626 0 1..364 1..364
TvLiP 626 0 1..364 1..370
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 728533..728593 61 N° 2 728652..728859 208 N° 3 728918..729052 135 N° 4 729106..729652 547
N° 5 729719..729793 75 N° 6 729852..729920 69  
join(728533..728593,728652..728859,728918..729052,729106..729652,729719..729793, 729852..729920)


exon

Literature and cross-references TvLiP08 (LiP8)
DNA ref. JGI genome:   scaffold_12 (728533..729920)
Protein sequence: TvLiP08 (LiP8)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364 (343)
PWM (Da):   %s   38537.93 (36501.9)  
PI (pH):   %s   4.22 (4.18) Peptide Signal:   %s   cut: 22 range:22-364
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFKSLLSVVSAAAALQGAYAALTRRVACPDGVNTATNAACCQLFAVREDLQQNLFHGGLCTAEAHESLRLTFHDAIAISPALEAQGIFGGGGADGSIAIFPEIETNFHPNIGLDEIIELQKPFIARHNISVADFIQFAGAIGASNCAGAPQLAAFVGRNDATQPAPDGLVPEPFHTPDQIFDRLADASQGEFDPILTVWLLTAHTVAAANDVDPTKSGLPFDSTPELWDTQFFLETQLRGTSFPGSGGNQGEVESPLAGEIRLQSDHTIARDSRTACEWQSFVDNQPKAQQMFQFVFHDLSIFGQDINQLVDCTEVPIPAAPQGHTHFPAGLSNADIEQACAETPFPTFPTDPGPKTAVAPV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTCAAGTCTCTTCTCTCCGTCGTCTCTGCCGCTGCAGCGCTCCAGGGAGCATACGGTGCGTAGGACGCGGTGGATGGCTGTCAACAGTGATCTGACGCATATCTATCTTCTAGC
CGCATTAACCCGCCGCGTCGCTTGCCCCGACGGCGTGAACACCGCTACCAACGCGGCGTGCTGCCAGCTCTTCGCCGTCCGCGAGGACCTCCAGCAGAACCTGTTCCACGGCGGTCTCTG
CACGGCTGAGGCGCACGAGTCTCTCCGCCTGACCTTCCACGACGCCATCGCTATCTCCCCCGCCCTCGAGGCCCAGGGCATCTTCGG
GTACGCTAAGCAAATTTGTGCACTTAGCCAACA
TCGTTAACCAGGACGCGCTGCTCAGTGGCGGCGGTGCCGACGGCTCCATCGCGATCTTCCCCGAGATCGAGACCAACTTCCACCCCAACATCGGTCTCGACGAGATCATTGAGCTCCAGA
AGCCGTTCATCGCCCGTCACAACATCTCCGTTGCCGACTT
GTAAGTCCCCGCAGTGAAGCAACGATGGCCTTTGTACTAATTCCTCGGCGCAGCATCCAATTCGCTGGTGCCATCGGTGC
CTCCAACTGCGCGGGCGCGCCCCAGCTCGCCGCCTTCGTCGGCCGCAACGACGCGACACAGCCCGCGCCCGACGGGCTCGTCCCCGAGCCGTTCCACACGCCGGACCAGATCTTCGACCG
CCTCGCGGACGCGTCGCAGGGCGAGTTCGACCCGATCCTGACCGTGTGGCTGCTCACCGCGCACACCGTCGCGGCCGCGAACGACGTCGACCCGACGAAGTCCGGGCTGCCGTTCGACTC
CACCCCAGAGCTCTGGGACACGCAGTTCTTCCTCGAGACGCAGCTGCGCGGGACGAGCTTCCCCGGGTCTGGGGGGAACCAGGGCGAGGTCGAGAGTCCCCTTGCTGGGGAGATCCGCCT
GCAGAGCGACCACACGATCGCGCGCGACTCGCGCACGGCGTGCGAGTGGCAGTCGTTTGTCGACAACCAGCCGAAGGCGCAGCAGATGTTCCAGTTCGTGTTCCACGATTTGTCGATCTT
CGGCCAGGACATCAACCAGCTCGTTGACTGCACGGAAGTC
GTACGTCGCCTCGTTCTACTGTGCCAGAGTACCCCTTGCGCAGGTCACTAAACGCTATCTGGATAGGTCCCCATCCCCGC
GGCGCCGCAGGGCCACACGCACTTCCCCGCCGGCCTGAGCAACGCTGACATCGAGCAGGCT
GTGAGTACACTCCGCGCACACGCTCTCCTTACCTTTCGACTGACACGTTCACCCATAGT
GCGCCGAGACTCCCTTCCCGACCTTCCCCACCGACCCCGGACCCAAGACCGCCGTCGCCCCCGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTCAAGTCTCTTCTCTCCGTCGTCTCTGCCGCTGCAGCGCTCCAGGGAGCATACGCCGCATTAACCCGCCGCGTCGCTTGCCCCGACGGCGTGAACACCGCTACCAACGCGGCG
TGCTGCCAGCTCTTCGCCGTCCGCGAGGACCTCCAGCAGAACCTGTTCCACGGCGGTCTCTGCACGGCTGAGGCGCACGAGTCTCTCCGCCTGACCTTCCACGACGCCATCGCTATCTCC
CCCGCCCTCGAGGCCCAGGGCATCTTCGG
TGGCGGCGGTGCCGACGGCTCCATCGCGATCTTCCCCGAGATCGAGACCAACTTCCACCCCAACATCGGTCTCGACGAGATCATTGAGCTC
CAGAAGCCGTTCATCGCCCGTCACAACATCTCCGTTGCCGACTT
CATCCAATTCGCTGGTGCCATCGGTGCCTCCAACTGCGCGGGCGCGCCCCAGCTCGCCGCCTTCGTCGGCCGCAAC
GACGCGACACAGCCCGCGCCCGACGGGCTCGTCCCCGAGCCGTTCCACACGCCGGACCAGATCTTCGACCGCCTCGCGGACGCGTCGCAGGGCGAGTTCGACCCGATCCTGACCGTGTGG
CTGCTCACCGCGCACACCGTCGCGGCCGCGAACGACGTCGACCCGACGAAGTCCGGGCTGCCGTTCGACTCCACCCCAGAGCTCTGGGACACGCAGTTCTTCCTCGAGACGCAGCTGCGC
GGGACGAGCTTCCCCGGGTCTGGGGGGAACCAGGGCGAGGTCGAGAGTCCCCTTGCTGGGGAGATCCGCCTGCAGAGCGACCACACGATCGCGCGCGACTCGCGCACGGCGTGCGAGTGG
CAGTCGTTTGTCGACAACCAGCCGAAGGCGCAGCAGATGTTCCAGTTCGTGTTCCACGATTTGTCGATCTTCGGCCAGGACATCAACCAGCTCGTTGACTGCACGGAAGTC
GTCCCCATC
CCCGCGGCGCCGCAGGGCCACACGCACTTCCCCGCCGGCCTGAGCAACGCTGACATCGAGCAGGCT
TGCGCCGAGACTCCCTTCCCGACCTTCCCCACCGACCCCGGACCCAAGACCGCC
GTCGCCCCCGTGTAA

Retrieve as FASTA