Entry information : TvLiP06 (LiP6)
Entry ID 9595
Creation 2011-10-05 (Christophe Dunand)
Last sequence changes 2011-10-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Christophe Dunand)
Peroxidase information: TvLiP06 (LiP6)
Name (synonym) TvLiP06 (LiP6)
Class Lignin peroxidase    [Orthogroup: LiP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvLiP06
start..stop
S start..stop
TvLiP03 656 0 1..364 1..364
TvLiP04 650 0 1..364 1..364
TvLiP10 649 0 1..364 1..364
TvLiP 647 0 1..364 1..370
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 194912..194972 61 N° 2 194640..194847 208 N° 3 194446..194580 135 N° 4 193845..194391 547
N° 5 193713..193787 75 N° 6 193598..193662 65 N° 7 193517..193544 28  
complement(join(193517..193544,193598..193662,193713..193787,193845..194391,1944 46..194580,194640..194847,194912..194972))


exon

Literature and cross-references TvLiP06 (LiP6)
DNA ref. JGI genome:   scaffold_12 (194972..193517)
Protein sequence: TvLiP06 (LiP6)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   372 (351)
PWM (Da):   %s   39409.35 (37236.2)  
PI (pH):   %s   4.29 (4.25) Peptide Signal:   %s   cut: 22 range:22-372
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKSLLTFVSLAATLSGTYAALTRRVACPDGVNTATNAACCQLFAVREDLQQNLFHGGLCTAEAHESLRLTFHDGIAISPALQSQGQFGGGGADGSISIFPDIETGFHPNIGLDEIVALQQPLFERHNLSHADFLHFAGAIAASNCAGAPQLVAYVGRKDATQPAPDGLVPEPFHTPDQIFDRLADASQGEFDPILTVWLLTAHTVAAANDVDPTESGLPFDSTPELWDTQFFLETQLRGTAFPGSGGNQGEVESPLAGEMRLQSDHTIARDSRTACEWQSFVDNQPKAQAMFQFVFNVLTTLGQDQNDLVNCTEVPIPAPPQGHTHFPAGLSIADIEQACAETPFPTLPTDPGPRTAVAPVPKPPPASI

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAATCTCTCCTCACCTTCGTCTCCCTCGCTGCAACCCTCTCTGGCACCTACGGTACGCGCCCCTCTGATCCCCTCATTTGCATTGTCATATTGACGTGTACCGACCGCTAC
TCTAGCCGCGCTGACGCGCCGCGTTGCTTGCCCCGACGGTGTCAACACTGCGACGAACGCGGCGTGCTGCCAGCTGTTCGCTGTCCGCGAGGACCTGCAGCAGAACCTGTTCCACGGCGG
TCTGTGCACTGCCGAGGCGCACGAGTCCCTCCGTCTCACATTCCACGACGGTATCGCGATCTCGCCCGCCCTCCAGTCGCAGGGCCAGTTCGG
GTACGTTGCGCGCATCTTTGAAGCATC
CAATAGACATACTAATGGAATGCGGTCTGCAGTGGCGGAGGTGCCGACGGCTCGATCTCGATCTTCCCCGATATCGAGACTGGCTTCCACCCCAACATCGGCCTCGACGAGATTGTCGCC
CTCCAGCAGCCGCTCTTTGAGCGCCACAACTTGTCGCACGCCGACTT
GTGAGTCTAACGCATACTCATCCGCATCGGTTCGCAGTGCTGACTCTCATTCAGCCTGCACTTCGCTGGTGCC
ATCGCTGCGTCGAACTGCGCCGGTGCGCCCCAGCTCGTCGCCTACGTCGGCCGCAAGGACGCTACCCAGCCCGCCCCAGACGGCCTCGTCCCCGAGCCGTTCCACACCCCCGACCAGATC
TTCGACCGTCTCGCCGACGCCTCCCAGGGCGAGTTTGACCCCATCCTGACCGTCTGGCTCCTGACCGCGCACACCGTCGCGGCGGCGAACGACGTCGACCCGACCGAGTCCGGCCTGCCA
TTCGACTCGACGCCCGAGCTGTGGGACACGCAGTTCTTCCTCGAGACGCAGCTGCGCGGCACCGCGTTCCCCGGCTCCGGCGGGAACCAGGGCGAGGTCGAGAGTCCGCTCGCGGGCGAG
ATGCGCCTGCAGAGCGACCACACGATCGCGCGCGACTCGCGCACGGCGTGCGAGTGGCAGTCGTTCGTCGACAACCAGCCGAAGGCGCAGGCGATGTTCCAGTTCGTCTTCAACGTGCTC
ACCACGCTCGGCCAGGACCAGAACGACCTCGTGAACTGCACTGAAGTC
GTACGTCCAACGTTCTCCCGCTAGCCTGTTGAAGGTGATGCTTACTCTCGCCTCTAGGTCCCGATCCCCGCG
CCGCCTCAGGGCCACACGCACTTCCCCGCTGGGCTGTCCATCGCCGACATCGAGCAGGCT
GTACGTCCGATGGCGTCTCTCTACTAAGACAATGCTGACTTCCCTTGTAGTGCGCTGAGA
CTCCCTTCCCCACCCTCCCGACTGACCCGGGACCCCGCACCGCTGTCGCCCCTGT
GTATGTCTTTATCAACCTCGCTTCGAGCTTTGCTGATGATGTGCCACCTGCAGCCCCAAGCCTCC
CCCCGCGTCGATCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAATCTCTCCTCACCTTCGTCTCCCTCGCTGCAACCCTCTCTGGCACCTACGCCGCGCTGACGCGCCGCGTTGCTTGCCCCGACGGTGTCAACACTGCGACGAACGCGGCG
TGCTGCCAGCTGTTCGCTGTCCGCGAGGACCTGCAGCAGAACCTGTTCCACGGCGGTCTGTGCACTGCCGAGGCGCACGAGTCCCTCCGTCTCACATTCCACGACGGTATCGCGATCTCG
CCCGCCCTCCAGTCGCAGGGCCAGTTCGG
TGGCGGAGGTGCCGACGGCTCGATCTCGATCTTCCCCGATATCGAGACTGGCTTCCACCCCAACATCGGCCTCGACGAGATTGTCGCCCTC
CAGCAGCCGCTCTTTGAGCGCCACAACTTGTCGCACGCCGACTT
CCTGCACTTCGCTGGTGCCATCGCTGCGTCGAACTGCGCCGGTGCGCCCCAGCTCGTCGCCTACGTCGGCCGCAAG
GACGCTACCCAGCCCGCCCCAGACGGCCTCGTCCCCGAGCCGTTCCACACCCCCGACCAGATCTTCGACCGTCTCGCCGACGCCTCCCAGGGCGAGTTTGACCCCATCCTGACCGTCTGG
CTCCTGACCGCGCACACCGTCGCGGCGGCGAACGACGTCGACCCGACCGAGTCCGGCCTGCCATTCGACTCGACGCCCGAGCTGTGGGACACGCAGTTCTTCCTCGAGACGCAGCTGCGC
GGCACCGCGTTCCCCGGCTCCGGCGGGAACCAGGGCGAGGTCGAGAGTCCGCTCGCGGGCGAGATGCGCCTGCAGAGCGACCACACGATCGCGCGCGACTCGCGCACGGCGTGCGAGTGG
CAGTCGTTCGTCGACAACCAGCCGAAGGCGCAGGCGATGTTCCAGTTCGTCTTCAACGTGCTCACCACGCTCGGCCAGGACCAGAACGACCTCGTGAACTGCACTGAAGTC
GTCCCGATC
CCCGCGCCGCCTCAGGGCCACACGCACTTCCCCGCTGGGCTGTCCATCGCCGACATCGAGCAGGCT
TGCGCTGAGACTCCCTTCCCCACCCTCCCGACTGACCCGGGACCCCGCACCGCT
GTCGCCCCTGT
CCCCAAGCCTCCCCCCGCGTCGATCTGA

Retrieve as FASTA