Entry information : TvLiP03 (LiP3)
Entry ID 9598
Creation 2011-10-05 (Christophe Dunand)
Last sequence changes 2011-10-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-27 (Catherine Mathe (Scipio))
Peroxidase information: TvLiP03 (LiP3)
Name (synonym) TvLiP03 (LiP3)
Class Lignin peroxidase    [Orthogroup: LiP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvLiP03
start..stop
S start..stop
TvLiP10 730 0 1..364 1..364
TvLiP04 688 0 1..364 1..364
TvLiP 683 0 1..364 1..370
TvLiP06 644 0 1..359 1..359
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 163314..163374 61 N° 2 163437..163779 343 N° 3 163830..164376 547 N° 4 164438..164512 75
N° 5 164568..164636 69  
join(163314..163374,163437..163779,163830..164376,164438..164512,164568..164636)


exon

Literature and cross-references TvLiP03 (LiP3)
DNA ref. JGI genome:   scaffold_12 (163314..164636)
Protein sequence: TvLiP03 (LiP3)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364 (343)
PWM (Da):   %s   38694.1 (36620.0)  
PI (pH):   %s   4.44 (4.39) Peptide Signal:   %s   cut: 22 range:22-364
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKSLLTIVSLAATLAGTNAALTRRVTCPDGVNTATNAACCQLFAVRQDLQQNLFHGGLCTAEAHESLRLTFHDGIAISPAMEAQGKFGGGGADGSISIFPEIETAFHPNIGLDEIVALQRPIQARHNLTHADFLHFAGALAASNCAGAPQLSAFVGRKDATQPAPDGLVPEPFHTPDQIFDRLADASEGEFDPILTVWLLTAHTVAAANDVDPTKSGLPFDSTPEIWDTQFFVETQLRGTLFPGKGGNQGEVESPLAGEMRLQSDHTIARDSRTACEWQSFVDNQPKAQAMFQFVFQVLSTLGQNQDDLVDCTEVPIPAPPQGRTHLPAGMTMNDIEQACAETPFPTLPIDPGPRTAVAPV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGAGCCTTCTGACCATCGTCTCTCTCGCCGCAACCCTCGCGGGCACCAACGGTACGAAGCTCATGATCGCTATACATTCATTCCGTCGTAGCTGACGTTGCTTTGTAACT
CAGCCGCACTGACGCGCCGCGTCACCTGCCCCGACGGCGTTAACACCGCGACGAACGCGGCGTGCTGCCAGCTGTTCGCTGTCCGACAGGACCTCCAGCAGAACCTGTTCCACGGCGGCC
TGTGCACTGCCGAGGCGCACGAATCCCTCCGCCTGACGTTCCACGATGGTATTGCCATCTCGCCCGCCATGGAGGCGCAAGGCAAGTTCGGCGGCGGCGGTGCCGATGGCTCCATCTCTA
TCTTCCCCGAGATTGAGACCGCCTTCCACCCCAACATCGGCCTCGACGAGATCGTCGCGCTCCAGCGGCCGATCCAAGCGCGCCACAACCTCACACACGCCGACTT
GTAAGTCTCACAGC
TGCTGAGCTCAAGAGAAAACACTGACCTGTCCATAGCCTGCACTTCGCTGGTGCACTCGCCGCGTCCAACTGCGCCGGTGCGCCCCAGCTCTCCGCATTCGTCGGCCGCAAGGACGCCAC
CCAGCCCGCACCCGACGGCCTCGTCCCCGAGCCGTTCCACACTCCCGACCAGATCTTCGACCGCCTCGCCGACGCGTCCGAGGGCGAGTTCGACCCCATCCTCACCGTCTGGCTCCTGAC
CGCGCACACCGTCGCGGCGGCCAACGACGTCGACCCGACCAAGTCCGGGCTGCCGTTCGACTCGACCCCCGAGATCTGGGACACGCAGTTCTTCGTGGAGACGCAGCTGCGCGGGACGCT
GTTCCCCGGAAAGGGGGGCAACCAGGGCGAGGTCGAGAGCCCGCTCGCCGGAGAGATGCGCCTGCAGAGCGACCACACGATCGCGCGTGACTCGCGCACGGCGTGCGAGTGGCAGTCGTT
CGTCGACAACCAGCCGAAGGCCCAGGCGATGTTCCAGTTCGTCTTCCAGGTGCTCTCTACCCTTGGCCAGAACCAGGATGACCTGGTTGACTGCACTGAAGTG
GTACGCCGCCGCGCTCC
TCCAATAGCCTATTGAATGTACCGCTAACTACTGGCGCTTCTAGGTCCCGATCCCCGCGCCGCCGCAGGGCCGCACTCATCTCCCCGCCGGCATGACCATGAACGACATCGAGCAAGCAG
TAAGGCCTCATTCCACATTATCCGCTACCAAATTGTACTCATTCTCGGGCACAGTGCGCCGAGACTCCCTTCCCCACCCTCCCGATCGACCCTGGACCGCGCACTGCTGTCGCCCCCGTG
TAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGAGCCTTCTGACCATCGTCTCTCTCGCCGCAACCCTCGCGGGCACCAACGCCGCACTGACGCGCCGCGTCACCTGCCCCGACGGCGTTAACACCGCGACGAACGCGGCG
TGCTGCCAGCTGTTCGCTGTCCGACAGGACCTCCAGCAGAACCTGTTCCACGGCGGCCTGTGCACTGCCGAGGCGCACGAATCCCTCCGCCTGACGTTCCACGATGGTATTGCCATCTCG
CCCGCCATGGAGGCGCAAGGCAAGTTCGGCGGCGGCGGTGCCGATGGCTCCATCTCTATCTTCCCCGAGATTGAGACCGCCTTCCACCCCAACATCGGCCTCGACGAGATCGTCGCGCTC
CAGCGGCCGATCCAAGCGCGCCACAACCTCACACACGCCGACTT
CCTGCACTTCGCTGGTGCACTCGCCGCGTCCAACTGCGCCGGTGCGCCCCAGCTCTCCGCATTCGTCGGCCGCAAG
GACGCCACCCAGCCCGCACCCGACGGCCTCGTCCCCGAGCCGTTCCACACTCCCGACCAGATCTTCGACCGCCTCGCCGACGCGTCCGAGGGCGAGTTCGACCCCATCCTCACCGTCTGG
CTCCTGACCGCGCACACCGTCGCGGCGGCCAACGACGTCGACCCGACCAAGTCCGGGCTGCCGTTCGACTCGACCCCCGAGATCTGGGACACGCAGTTCTTCGTGGAGACGCAGCTGCGC
GGGACGCTGTTCCCCGGAAAGGGGGGCAACCAGGGCGAGGTCGAGAGCCCGCTCGCCGGAGAGATGCGCCTGCAGAGCGACCACACGATCGCGCGTGACTCGCGCACGGCGTGCGAGTGG
CAGTCGTTCGTCGACAACCAGCCGAAGGCCCAGGCGATGTTCCAGTTCGTCTTCCAGGTGCTCTCTACCCTTGGCCAGAACCAGGATGACCTGGTTGACTGCACTGAAGTG
GTCCCGATC
CCCGCGCCGCCGCAGGGCCGCACTCATCTCCCCGCCGGCATGACCATGAACGACATCGAGCAAGCA
TGCGCCGAGACTCCCTTCCCCACCCTCCCGATCGACCCTGGACCGCGCACTGCT
GTCGCCCCCGTGTAA

Retrieve as FASTA