Entry information : TvLiP10 (LiP10)
Entry ID 9599
Creation 2011-10-05 (Christophe Dunand)
Last sequence changes 2011-10-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-27 (Catherine Mathe (Scipio))
Peroxidase information: TvLiP10 (LiP10)
Name (synonym) TvLiP10 (LiP10)
Class Lignin peroxidase    [Orthogroup: LiP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvLiP10
start..stop
S start..stop
TvLiP03 730 0 1..364 1..364
TvLiP04 685 0 1..364 1..364
TvLiP 681 0 1..364 1..370
TvLiP06 636 0 1..359 1..359
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 458131..458191 61 N° 2 457862..458069 208 N° 3 457673..457807 135 N° 4 457072..457618 547
N° 5 456931..457005 75 N° 6 456808..456876 69  
complement(join(456808..456876,456931..457005,457072..457618,457673..457807,4578 62..458069,458131..458191))


exon

Literature and cross-references TvLiP10 (LiP10)
DNA ref. JGI genome:   scaffold_13 (458191..456808)
Protein sequence: TvLiP10 (LiP10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364 (343)
PWM (Da):   %s   38755.28 (36623.1)  
PI (pH):   %s   4.5 (4.44) Peptide Signal:   %s   cut: 22 range:22-364
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKSLLTIVSLVATLTGTNAALTRRVTCPDGKNTATNAACCQLFAVRQDLQQNLFHGGLCTAEAHESLRLTFHDGIAISPALEAQGKFGGGGADGSISIFPEIETAFHPNIGLDEIVALQRPIQARHNLTHADFLHFAGALAASNCAGAPQLSAFVGRKDATQPAPDGLVPEPFHTPDQIFDRLADASEGEFDPILTVWLLTAHTVAAANDVDPTKSGLPFDSTPEIWDTQFFVETQLRGTLFPGKGGNQGEVESPLAGEIRLQSDHTIARDPRTACEWQSFVDNQPKAQAMFQFVFQVLSTLGQNQDDLVDCTEVPIPAPPQGRTHLPAGMTMNDIEQACAETPFPTLPIDPGPRTAVAPV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGAGCCTTCTGACCATCGTCTCTCTCGTTGCAACCCTCACGGGCACCAATGGTACGCAGTGCACGAGCACCACTCACTCGCCGTGTTCTGACCATTCTTCGCTTGCTACC
AGCCGCGCTGACGCGCCGCGTTACCTGCCCCGATGGCAAGAACACTGCGACGAACGCGGCGTGTTGCCAGCTGTTCGCCGTTCGCCAGGATCTGCAACAGAACCTCTTCCATGGCGGTCT
CTGCACGGCTGAGGCGCACGAGTCCCTCCGCCTGACGTTCCACGACGGCATCGCCATCTCGCCCGCCCTGGAGGCGCAAGGAAAGTTCGG
GTACGTCTGACAGACCTTTCGGCCCCTCGT
TAGCTCTTTCTGACCGCTTTGTAGTGGTGGAGGTGCTGACGGCTCCATCTCGATCTTCCCCGAGATCGAGACTGCCTTCCACCCCAACATCGGCCTCGACGAGATCGTCGCGCTCCAGCG
GCCGATCCAGGCGCGCCACAACCTGACGCACGCCGACTT
GTGAGTAGAGAGCACGCCCACTTCCTTCAGCTTGGCTGACTGACGCTGTACCAGCCTTCACTTCGCCGGCGCCCTCGCCGC
GTCGAACTGCGCGGGTGCGCCCCAGCTCTCCGCCTTCGTCGGCCGCAAGGACGCCACCCAGCCCGCGCCCGACGGGCTTGTCCCCGAGCCGTTCCACACGCCCGACCAGATCTTCGACCG
CCTCGCGGACGCGTCCGAGGGCGAGTTCGACCCGATCCTGACCGTGTGGCTGCTCACTGCGCACACCGTCGCCGCGGCGAACGACGTCGACCCGACGAAGTCCGGGCTGCCGTTCGACTC
GACCCCCGAGATCTGGGACACGCAGTTCTTCGTCGAGACGCAGCTGCGCGGGACGCTCTTCCCGGGCAAGGGCGGGAACCAGGGCGAGGTCGAGAGCCCGCTCGCGGGCGAGATCCGTCT
GCAGAGCGACCACACGATCGCGCGCGACCCGCGCACGGCGTGCGAGTGGCAGTCGTTCGTCGATAACCAGCCGAAGGCGCAGGCGATGTTCCAGTTCGTCTTCCAGGTGCTCTCCACGCT
CGGCCAGAACCAGGACGATCTCGTCGACTGCACTGAAGTC
GTACGTCGCGCCCCTTGTCTTCCCTCAGCCGTTTTCGAGCTCGATGCTGATTGATTCCCGCAACAGGTTCCGATCCCCGC
GCCGCCCCAGGGCCGCACTCACCTTCCGGCTGGCATGACAATGAACGACATCGAGCAGGCC
GTAAGCATCATTTATAGCTCGTCTTCTACGGATTCCTAATGCGTTTACATACAGTGCGC
CGAGACTCCGTTCCCCACTCTCCCCATCGACCCCGGACCCCGCACCGCCGTCGCCCCCGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGAGCCTTCTGACCATCGTCTCTCTCGTTGCAACCCTCACGGGCACCAATGCCGCGCTGACGCGCCGCGTTACCTGCCCCGATGGCAAGAACACTGCGACGAACGCGGCG
TGTTGCCAGCTGTTCGCCGTTCGCCAGGATCTGCAACAGAACCTCTTCCATGGCGGTCTCTGCACGGCTGAGGCGCACGAGTCCCTCCGCCTGACGTTCCACGACGGCATCGCCATCTCG
CCCGCCCTGGAGGCGCAAGGAAAGTTCGG
TGGTGGAGGTGCTGACGGCTCCATCTCGATCTTCCCCGAGATCGAGACTGCCTTCCACCCCAACATCGGCCTCGACGAGATCGTCGCGCTC
CAGCGGCCGATCCAGGCGCGCCACAACCTGACGCACGCCGACTT
CCTTCACTTCGCCGGCGCCCTCGCCGCGTCGAACTGCGCGGGTGCGCCCCAGCTCTCCGCCTTCGTCGGCCGCAAG
GACGCCACCCAGCCCGCGCCCGACGGGCTTGTCCCCGAGCCGTTCCACACGCCCGACCAGATCTTCGACCGCCTCGCGGACGCGTCCGAGGGCGAGTTCGACCCGATCCTGACCGTGTGG
CTGCTCACTGCGCACACCGTCGCCGCGGCGAACGACGTCGACCCGACGAAGTCCGGGCTGCCGTTCGACTCGACCCCCGAGATCTGGGACACGCAGTTCTTCGTCGAGACGCAGCTGCGC
GGGACGCTCTTCCCGGGCAAGGGCGGGAACCAGGGCGAGGTCGAGAGCCCGCTCGCGGGCGAGATCCGTCTGCAGAGCGACCACACGATCGCGCGCGACCCGCGCACGGCGTGCGAGTGG
CAGTCGTTCGTCGATAACCAGCCGAAGGCGCAGGCGATGTTCCAGTTCGTCTTCCAGGTGCTCTCCACGCTCGGCCAGAACCAGGACGATCTCGTCGACTGCACTGAAGTC
GTTCCGATC
CCCGCGCCGCCCCAGGGCCGCACTCACCTTCCGGCTGGCATGACAATGAACGACATCGAGCAGGCC
TGCGCCGAGACTCCGTTCCCCACTCTCCCCATCGACCCCGGACCCCGCACCGCC
GTCGCCCCCGTGTAA

Retrieve as FASTA