Entry information : TvLiP01 (LiP1)
Entry ID 9601
Creation 2011-10-05 (Christophe Dunand)
Last sequence changes 2011-10-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-27 (Catherine Mathe (Scipio))
Peroxidase information: TvLiP01 (LiP1)
Name (synonym) TvLiP01 (LiP1)
Class Lignin peroxidase    [Orthogroup: LiP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvLiP01
start..stop
S start..stop
TvLiP09 609 0 1..365 1..361
TvLiP02_PRL572 570 0 1..366 1..365
TvLiP02 570 0 1..366 1..365
TvLiP12_PRL572 568 0 1..367 1..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2744080..2744143 64 N° 2 2744203..2744410 208 N° 3 2744469..2744603 135 N° 4 2744659..2745205 547
N° 5 2745262..2745336 75 N° 6 2745390..2745454 65 N° 7 2745511..2745520 10  
join(2744080..2744143,2744203..2744410,2744469..2744603,2744659..2745205,2745262 ..2745336,2745390..2745454,2745511..2745520)


exon

Literature and cross-references TvLiP01 (LiP1)
DNA ref. JGI genome:   scaffold_2 (2744080..2745520)
Protein sequence: TvLiP01 (LiP1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   367 (346)
PWM (Da):   %s   39437.47 (37331.3)  
PI (pH):   %s   4.49 (4.44) Peptide Signal:   %s   cut: 22 range:22-367
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKLLSSFVALAAALQGVSTAALNRRVACPDGVHTASNEACCQLFAVREDLQKNLFDGAQCNAEAHESLRLTFHDAIAISPALEAQGTFGGGGADGSIAIFSHIETAFHPNIGLDEIVEKQRPFIERHNLGVADFIQFAGALGASNCPGAPQLSAFVGRKDATRPAPDGLVPEPFHTPDMIFDRLADASQGEFDPILTVWLLTAHTVAAANDVDPTIPGSPFDSTPSQFDSQFFLETQLKGTLFPGDGPNQGEVESPMRGEFRLQSDFAIARDERTACEWQSFVNNQTKVQQMFQFVFHDLSLFGQNITDLVDCTEIPVPKPLREATHFPAGFTVRDIEHACAETPFPTLPTQAGPRTSVAPVPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCTGCTCTCTTCTTTCGTTGCTCTCGCCGCTGCCCTCCAGGGAGTGAGCACCGGTGTGTAGCAGTCTGTCGGCGGGAGATTTAAACCTGTTATTGATGTTATCTTCACT
TAGCTGCGTTGAACCGTCGTGTGGCCTGCCCCGATGGTGTCCACACTGCCAGCAACGAGGCGTGCTGCCAGCTCTTCGCCGTCCGCGAGGATCTGCAGAAGAACTTGTTCGACGGTGCTC
AGTGCAACGCCGAGGCGCACGAGTCTCTCCGTCTGACGTTCCACGACGCCATCGCCATCTCGCCCGCCCTTGAGGCCCAGGGCACCTTCGG
GTCAGTCAACTCGCTGTGATGCTGTTCCG
CTAATTCCGCTAACTTGGCCTCGATACAGTGGTGGAGGTGCCGACGGTTCGATCGCGATCTTCTCGCACATCGAGACCGCGTTCCACCCTAACATCGGTCTCGACGAGATCGTGGAGAAG
CAGCGGCCGTTCATTGAGCGCCACAACCTCGGCGTTGCTGACTT
GTAAGTCCTGATTCCTTGTCACCTTATCCCGGGCGTTGCTGATGAGTGTGTGCAGCATCCAGTTCGCCGGTGCGCT
CGGCGCGTCCAACTGCCCCGGAGCTCCCCAGCTCTCCGCCTTCGTCGGCCGCAAGGATGCGACGCGCCCCGCCCCCGACGGCCTCGTCCCCGAGCCGTTCCACACCCCCGACATGATCTT
CGACCGCCTCGCGGACGCGTCCCAGGGCGAGTTCGACCCGATCCTGACGGTCTGGCTCCTGACCGCGCACACCGTTGCCGCGGCCAACGACGTCGACCCGACGATCCCCGGTTCGCCCTT
CGACTCCACCCCCAGCCAGTTCGACTCGCAGTTCTTCCTGGAGACGCAGCTCAAGGGCACCCTCTTCCCTGGAGATGGCCCCAACCAGGGCGAGGTCGAGTCCCCGATGCGCGGCGAGTT
CCGTCTCCAGTCGGACTTCGCGATCGCGCGCGACGAGCGCACGGCGTGCGAGTGGCAGTCGTTCGTGAACAACCAGACGAAGGTCCAGCAAATGTTCCAGTTCGTGTTCCACGACCTTTC
GCTGTTCGGCCAGAACATCACCGACCTCGTCGACTGCACGGAAGTG
GTGCGTCTCCATCTGGTACTACGTTGTCGTTCAAGCCTGACATCTTGTCTGTGCAGATCCCCGTCCCGAAGCCA
CTCAGGGAGGCGACGCACTTCCCCGCTGGCTTCACCGTCCGCGACATCGAGCACGCT
GTAAGCAGCCCGATCTATAGTATTCGCACGTTGGTTCTAATCTCGTTTTTCAGTGCGCGGAGA
CTCCCTTCCCCACCCTTCCGACCCAGGCTGGCCCGAGGACCTCCGTTGCCCCCGT
GTAAGATCGCACGCCTTCGCAGTATATCTCACGATGCTCACATGTGTACTTTATAGCCCCTCTTG
A

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCTGCTCTCTTCTTTCGTTGCTCTCGCCGCTGCCCTCCAGGGAGTGAGCACCGCTGCGTTGAACCGTCGTGTGGCCTGCCCCGATGGTGTCCACACTGCCAGCAACGAG
GCGTGCTGCCAGCTCTTCGCCGTCCGCGAGGATCTGCAGAAGAACTTGTTCGACGGTGCTCAGTGCAACGCCGAGGCGCACGAGTCTCTCCGTCTGACGTTCCACGACGCCATCGCCATC
TCGCCCGCCCTTGAGGCCCAGGGCACCTTCGG
TGGTGGAGGTGCCGACGGTTCGATCGCGATCTTCTCGCACATCGAGACCGCGTTCCACCCTAACATCGGTCTCGACGAGATCGTGGAG
AAGCAGCGGCCGTTCATTGAGCGCCACAACCTCGGCGTTGCTGACTT
CATCCAGTTCGCCGGTGCGCTCGGCGCGTCCAACTGCCCCGGAGCTCCCCAGCTCTCCGCCTTCGTCGGCCGC
AAGGATGCGACGCGCCCCGCCCCCGACGGCCTCGTCCCCGAGCCGTTCCACACCCCCGACATGATCTTCGACCGCCTCGCGGACGCGTCCCAGGGCGAGTTCGACCCGATCCTGACGGTC
TGGCTCCTGACCGCGCACACCGTTGCCGCGGCCAACGACGTCGACCCGACGATCCCCGGTTCGCCCTTCGACTCCACCCCCAGCCAGTTCGACTCGCAGTTCTTCCTGGAGACGCAGCTC
AAGGGCACCCTCTTCCCTGGAGATGGCCCCAACCAGGGCGAGGTCGAGTCCCCGATGCGCGGCGAGTTCCGTCTCCAGTCGGACTTCGCGATCGCGCGCGACGAGCGCACGGCGTGCGAG
TGGCAGTCGTTCGTGAACAACCAGACGAAGGTCCAGCAAATGTTCCAGTTCGTGTTCCACGACCTTTCGCTGTTCGGCCAGAACATCACCGACCTCGTCGACTGCACGGAAGTG
ATCCCC
GTCCCGAAGCCACTCAGGGAGGCGACGCACTTCCCCGCTGGCTTCACCGTCCGCGACATCGAGCACGCT
TGCGCGGAGACTCCCTTCCCCACCCTTCCGACCCAGGCTGGCCCGAGGACC
TCCGTTGCCCCCGT
CCCCTCTTGA

Retrieve as FASTA