Entry information : TvLiP07 (VP1)
Entry ID 9603
Creation 2011-10-05 (Christophe Dunand)
Last sequence changes 2012-03-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-10-05 (Christophe Dunand)
Peroxidase information: TvLiP07 (VP1)
Name (synonym) TvLiP07 (VP1)
Class Lignin peroxidase    [Orthogroup: LiP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvLiP07
start..stop
S start..stop
TvLiP07_PRL572 750 0 1..368 1..368
TvLiP12_PRL572 542 0 1..365 1..365
TvLiP12 542 0 1..365 1..365
TvLiP10 531 0 1..364 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1842926..1842986 61 N° 2 1842665..1842872 208 N° 3 1842464..1842598 135 N° 4 1841859..1842405 547
N° 5 1841723..1841797 75 N° 6 1841602..1841666 65 N° 7 1841529..1841544 16  
complement(join(1841529..1841544,1841602..1841666,1841723..1841797,1841859..1842 405,1842464..1842598,1842665..1842872,1842926..1842986))


exon

Literature and cross-references TvLiP07 (VP1)
DNA ref. JGI genome:   scaffold_2 (1842986..1841529)
Protein sequence: TvLiP07 (VP1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   368
PWM (Da):   %s   39189.26  
PI (pH):   %s   4.52
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKALLSAVSLIAALQGASAALTRRVACPDGKNTATNAACCSLFAVRDDIQQNLFHGAQCGENAHESLRITFHDAISFSPAMEARGQFGGGGADGSIAIFPDIETNFHANIGLDEIVAEQAPIQARHNLSHADFIMFAGALGTSNCPGAPRLDFFLGRKDATRPAPDGLVPEPFDTLEDVFARLADASAGEFDEILTVWLLTAHTIAATDHLDPTIPGTPMDSTPHIWDTQFFIETQLRGTAFPGTGGNHGEVMSPLKGEIRLQTDHLLARDSRTSCEWQSFVNNQQKAQDMFAFVFHDLSMLGQDPDSLIDCSEIPQPAPVIGKAHFPAGLTNKDIEQACADTPFPTLPTDPGPKTTVAAVPINS

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTCAAGGCTCTTCTCTCCGCCGTCTCGCTTATAGCGGCCCTCCAGGGCGCGAGCGGTAAGCCCCTCAGACTTCCGGGATCGACATATGCTCATCGCCTTCTTCGCTAGCTGCGC
TGACGCGCCGCGTCGCTTGCCCCGACGGCAAGAACACCGCGACCAACGCGGCGTGCTGCTCGCTCTTCGCCGTCCGCGACGACATCCAGCAGAACCTGTTCCACGGTGCCCAGTGCGGCG
AGAACGCGCACGAGTCCCTCCGCATCACCTTCCACGACGCCATCAGTTTCTCGCCCGCCATGGAGGCCCGCGGCCAGTTCGG
GTGCGTTGAGCCACACCGCCGCCCACCCCACTAGTAGT
GCATGATTCGCTAACGGTGGCCATGCAGCGGTGGAGGCGCAGACGGCTCTATTGCCATCTTCCCCGACATCGAGACCAACTTCCACGCGAACATCGGTCTTGACGAGATTGTCGCTGAGC
AGGCGCCGATTCAGGCCCGCCACAACCTCTCGCACGCCGACTT
GTGAGTGCTCTCATTTGTATGTTCCGGTTAGTGCCCTTACAAGCCGGCCCTTTCTTAGCATCATGTTCGCGGGTGCT
CTCGGCACATCCAACTGCCCCGGCGCCCCCCGCCTCGACTTCTTCCTCGGTCGCAAGGACGCGACGCGCCCGGCGCCCGACGGGCTCGTGCCGGAGCCGTTTGACACGCTCGAGGACGTC
TTCGCGCGTCTCGCAGACGCCTCCGCCGGCGAGTTCGACGAGATCCTGACGGTGTGGCTGCTCACCGCGCACACGATCGCGGCGACGGACCACCTGGACCCGACGATCCCGGGCACGCCG
ATGGACTCGACGCCGCACATCTGGGATACGCAGTTCTTCATCGAGACGCAGCTGCGCGGGACCGCGTTCCCGGGCACGGGCGGCAACCACGGCGAGGTGATGTCGCCGCTGAAGGGCGAG
ATCCGGCTGCAGACGGACCACCTGCTCGCGCGCGACTCGCGCACGAGCTGCGAGTGGCAGTCGTTCGTGAACAACCAGCAGAAGGCGCAGGACATGTTCGCGTTCGTGTTCCACGACCTC
TCGATGCTCGGCCAGGACCCGGACAGCCTCATCGACTGCAGCGAGCTG
GTGAGTAATACTCGGAGGCCTTTGGAAAGCGGTAGGGTGCTGACGAGCGTGGCTCGTGTAGATCCCGCAACC
CGCTCCCGTCATCGGCAAGGCGCACTTCCCCGCTGGCCTCACCAACAAGGACATCGAGCAGGCG
GTACGCTTAACCTTTGAATATTTTCCAGTGAGCTTCACTCAAGCGAGGGCATTTAG

TGCGCGGACACCCCCTTCCCCACGCTCCCGACCGACCCTGGCCCCAAGACCACCGTCGCCGCCGT
GTAAGTCGCCCATTTTATTGCGCACCTGTCCTCCCGCTCACTTCAGGGATGATGC
AGCCCCATCAACTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTCAAGGCTCTTCTCTCCGCCGTCTCGCTTATAGCGGCCCTCCAGGGCGCGAGCGCTGCGCTGACGCGCCGCGTCGCTTGCCCCGACGGCAAGAACACCGCGACCAACGCGGCG
TGCTGCTCGCTCTTCGCCGTCCGCGACGACATCCAGCAGAACCTGTTCCACGGTGCCCAGTGCGGCGAGAACGCGCACGAGTCCCTCCGCATCACCTTCCACGACGCCATCAGTTTCTCG
CCCGCCATGGAGGCCCGCGGCCAGTTCGG
CGGTGGAGGCGCAGACGGCTCTATTGCCATCTTCCCCGACATCGAGACCAACTTCCACGCGAACATCGGTCTTGACGAGATTGTCGCTGAG
CAGGCGCCGATTCAGGCCCGCCACAACCTCTCGCACGCCGACTT
CATCATGTTCGCGGGTGCTCTCGGCACATCCAACTGCCCCGGCGCCCCCCGCCTCGACTTCTTCCTCGGTCGCAAG
GACGCGACGCGCCCGGCGCCCGACGGGCTCGTGCCGGAGCCGTTTGACACGCTCGAGGACGTCTTCGCGCGTCTCGCAGACGCCTCCGCCGGCGAGTTCGACGAGATCCTGACGGTGTGG
CTGCTCACCGCGCACACGATCGCGGCGACGGACCACCTGGACCCGACGATCCCGGGCACGCCGATGGACTCGACGCCGCACATCTGGGATACGCAGTTCTTCATCGAGACGCAGCTGCGC
GGGACCGCGTTCCCGGGCACGGGCGGCAACCACGGCGAGGTGATGTCGCCGCTGAAGGGCGAGATCCGGCTGCAGACGGACCACCTGCTCGCGCGCGACTCGCGCACGAGCTGCGAGTGG
CAGTCGTTCGTGAACAACCAGCAGAAGGCGCAGGACATGTTCGCGTTCGTGTTCCACGACCTCTCGATGCTCGGCCAGGACCCGGACAGCCTCATCGACTGCAGCGAGCTG
ATCCCGCAA
CCCGCTCCCGTCATCGGCAAGGCGCACTTCCCCGCTGGCCTCACCAACAAGGACATCGAGCAGGCG
TGCGCGGACACCCCCTTCCCCACGCTCCCGACCGACCCTGGCCCCAAGACCACC
GTCGCCGCCGT
CCCCATCAACTCTTAA

Retrieve as FASTA