Entry information : FmeMnP12
Entry ID 9609
Creation 2011-10-14 (Christophe Dunand)
Last sequence changes 2011-10-14 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-06-01 (Catherine Mathe)
Peroxidase information: FmeMnP12
Name FmeMnP12
Class Manganese peroxidase    [Orthogroup: MnP005]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Hymenochaetaceae Fomitiporia
Organism Fomitiporia mediterranea    [TaxId: 208960 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FmeMnP12
start..stop
S start..stop
FmeMnP13 588 0 1..344 1..344
FmeMnP14 457 5e-163 1..344 1..341
PcriCIIBB07 387 7e-135 1..341 1..356
FmeCIIBB01 371 1e-128 18..341 18..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3273768..3274281 514 N° 2 3274350..3274727 378 N° 3 3274790..3274919 130 N° 4 3274974..3274986 13
join(3273768..3274281,3274350..3274727,3274790..3274919,3274974..3274986)


exon

Literature and cross-references FmeMnP12
DNA ref. JGI genome:   scaffold_1 (3273768..3274986)
Protein sequence: FmeMnP12
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344 (323)
PWM (Da):   %s   35624.26 (33613.2)  
PI (pH):   %s   4.11 (4.06) Peptide Signal:   %s   cut: 22 range:22-344
Sequence 385
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFKALFAIASLAASLSGSSAALTRRVTCPDGVNTATNAACCPFFALRDDLQTNLFENECGEEVRGMLRLVFHDGIAFSPTLGGGGADGSILTFSDTELTFAANGGNGGVEDFVDALKPFLAKHNVSAGDLVHFAGAFGITNCEGTPQVQFLAGRPNATAAAPDGLVSQPGDSVDTIIARFADAGFSSDELVALLASHSLAAADTLTGTVQGEPFDSTAHIFDSQFFIETRLHSAIPGEARLPSDAAIARDDRTSCTWQSFIDDENSMRSAFGAAMAKLAVVGQDVSQLVDCSELIPQPPAHNPDPFFPGTSTLSDVDAACTQTPFPTLTQNTAVTSVTPVNEF

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCTTTCAAGGCCCTCTTTGCCATCGCCTCCCTTGCTGCGAGTCTCTCTGGCTCCTCTGCAGCACTCACTCGTCGTGTTACTTGCCCTGATGGCGTTAACACTGCTACAAATGCTGCCT
GTTGTCCTTTCTTTGCTCTTCGCGATGACCTTCAAACCAATCTGTTCGAGAATGAATGTGGTGAAGAGGTCCGCGGAATGCTTCGTCTGGTTTTCCACGACGGGATTGCATTCTCGCCAA
CTCTTGGTGGTGGCGGAGCTGACGGCTCGATCCTCACGTTTTCTGACACAGAACTGACGTTCGCCGCCAACGGTGGTAACGGCGGTGTCGAGGATTTCGTCGACGCATTGAAACCTTTCC
TTGCGAAGCACAATGTCTCCGCTGGTGACTTGGTTCACTTCGCTGGTGCGTTCGGCATCACCAATTGCGAAGGCACTCCCCAAGTTCAGTTCCTCGCGGGTCGTCCAAACGCCACTGCAG
CAGCTCCTGATGGACTCGTTTCTCAACCAGGAG
GTAATTTGTTCATCTGTTCATCTAGGTCCAGCTTGATCAACATAGTGACAGTGGTATCTTTTTTCTAGACTCTGTTGATACTATCAT
CGCTCGCTTCGCCGACGCTGGCTTCAGTTCGGACGAACTTGTTGCCTTGCTCGCATCCCACTCACTCGCCGCGGCCGATACACTCACAGGTACTGTTCAAGGTGAACCATTCGACAGCAC
TGCGCATATTTTCGATAGTCAGTTCTTCATCGAGACACGTTTGCACTCCGCGATTCCTGGAGAGGCTCGCCTTCCATCCGATGCGGCTATCGCCCGTGACGACCGTACTTCGTGCACGTG
GCAGAGCTTCATTGACGACGAAAATTCGATGCGTAGCGCTTTTGGCGCCGCCATGGCTAAGCTTGCTGTTGTTGGCCAGGACGTTTCTCAGCTCGTTGACTGCTCAGAACTCATTCCTC
G
TAAATTACTCTCCTTTGCTGTATTGCCTTTTGATACTTGTGACTAAGGATAAATTTTCAAGAACCTCCGGCGCACAACCCTGACCCGTTCTTCCCTGGAACGTCAACCCTCTCCGATGTC
GATGCAGCGTGCACTCAAACACCTTTCCCGACTCTTACGCAGAACACGGCTGTCACATCAGTCACTCCCGT
GTAAGTTATCATCTTGATTGGCAGTCGAAAAATTATTGATTTTTCGTGG
CATAGTAATGAGTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCTTTCAAGGCCCTCTTTGCCATCGCCTCCCTTGCTGCGAGTCTCTCTGGCTCCTCTGCAGCACTCACTCGTCGTGTTACTTGCCCTGATGGCGTTAACACTGCTACAAATGCTGCCT
GTTGTCCTTTCTTTGCTCTTCGCGATGACCTTCAAACCAATCTGTTCGAGAATGAATGTGGTGAAGAGGTCCGCGGAATGCTTCGTCTGGTTTTCCACGACGGGATTGCATTCTCGCCAA
CTCTTGGTGGTGGCGGAGCTGACGGCTCGATCCTCACGTTTTCTGACACAGAACTGACGTTCGCCGCCAACGGTGGTAACGGCGGTGTCGAGGATTTCGTCGACGCATTGAAACCTTTCC
TTGCGAAGCACAATGTCTCCGCTGGTGACTTGGTTCACTTCGCTGGTGCGTTCGGCATCACCAATTGCGAAGGCACTCCCCAAGTTCAGTTCCTCGCGGGTCGTCCAAACGCCACTGCAG
CAGCTCCTGATGGACTCGTTTCTCAACCAGGAG
ACTCTGTTGATACTATCATCGCTCGCTTCGCCGACGCTGGCTTCAGTTCGGACGAACTTGTTGCCTTGCTCGCATCCCACTCACTCG
CCGCGGCCGATACACTCACAGGTACTGTTCAAGGTGAACCATTCGACAGCACTGCGCATATTTTCGATAGTCAGTTCTTCATCGAGACACGTTTGCACTCCGCGATTCCTGGAGAGGCTC
GCCTTCCATCCGATGCGGCTATCGCCCGTGACGACCGTACTTCGTGCACGTGGCAGAGCTTCATTGACGACGAAAATTCGATGCGTAGCGCTTTTGGCGCCGCCATGGCTAAGCTTGCTG
TTGTTGGCCAGGACGTTTCTCAGCTCGTTGACTGCTCAGAACTCATTCCTC
AACCTCCGGCGCACAACCCTGACCCGTTCTTCCCTGGAACGTCAACCCTCTCCGATGTCGATGCAGCGT
GCACTCAAACACCTTTCCCGACTCTTACGCAGAACACGGCTGTCACATCAGTCACTCCCGT
TAATGAGTTCTGA

Retrieve as FASTA