Entry information : FmeMnP14
Entry ID 9611
Creation 2011-10-14 (Christophe Dunand)
Last sequence changes 2011-10-14 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-06-01 (Catherine Mathe)
Peroxidase information: FmeMnP14
Name FmeMnP14
Class Manganese peroxidase    [Orthogroup: MnP005]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Hymenochaetaceae Fomitiporia
Organism Fomitiporia mediterranea    [TaxId: 208960 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FmeMnP14
start..stop
S start..stop
FmeMnP13 468 2e-167 1..341 1..344
FmeMnP12 449 6e-160 1..341 1..344
PoVP04_PC15 339 4e-116 1..330 1..345
PoVP04_PC9 338 5e-116 1..329 1..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3320339..3320843 505 N° 2 3320918..3321295 378 N° 3 3321351..3321480 130 N° 4 3321541..3321553 13
join(3320339..3320843,3320918..3321295,3321351..3321480,3321541..3321553)


exon

Literature and cross-references FmeMnP14
DNA ref. JGI genome:   scaffold_1 (3320339..3321553)
Protein sequence: FmeMnP14
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341 (323)
PWM (Da):   %s   36081.59 (34048.5)  
PI (pH):   %s   4.39 (4.33) Peptide Signal:   %s   cut: 19 range:19-341
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFNKFFALLTVLSISYAAPNPQLTLCPNLHLASNAACCKFFDLRDDLQNNLFSNTCGERVREALRLTFHDAIAFSPTKGGGGADGSIITFANTELQFAANGGNGGVEEFVATLTPFGPKHNVTPGDLIQFAGMLGITNCPGTPRVQFFAGRPDPVAAAPDGLVNLPTDDVDTILARFNDAGFSADELVALLSSHSIAGADTFVGDGGGDPFDSTAHVYDSQFFVDTRLHNPVPGEGRLPTDNLLARDDRTACTWQSFINNEDKMRSAFAAAFLKMSLLGQDQSKLVDCSEVIPHSPGHAQNAFFPGNATINDVDAACTQSPFPSLPQDPAITSLATINEF

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCAACAAGTTCTTTGCACTTCTAACGGTCCTCTCCATCTCCTATGCCGCACCTAACCCACAGCTTACACTTTGTCCTAATCTACATCTCGCTTCGAATGCGGCATGCTGCAAG
TTTTTCGACCTCCGGGACGACCTGCAAAATAACCTTTTTAGTAATACCTGTGGAGAACGGGTTCGTGAGGCGCTTCGACTGACCTTCCACGACGCTATCGCTTTCTCGCCGACGAAAGGC
GGTGGAGGAGCGGATGGCTCGATTATCACGTTTGCGAACACGGAACTCCAGTTTGCCGCAAATGGGGGCAATGGCGGTGTTGAGGAATTCGTCGCAACACTGACACCATTCGGCCCGAAG
CACAATGTTACTCCTGGGGACCTAATCCAGTTCGCGGGCATGCTCGGCATTACGAACTGCCCGGGCACACCGCGCGTTCAGTTCTTCGCGGGAAGACCAGACCCAGTTGCTGCTGCTCCT
GACGGCCTCGTCAACCTGCCAACAG
GTAGATACTATTTTTGACTTTTCACCTTTTATTTGGCAAGTCAGTGCTAAATACGCTATTTATCAACTACCTAGATGATGTTGATACGATTCTTG
CGCGCTTCAACGATGCTGGCTTTAGTGCGGATGAGCTCGTCGCCCTTCTTTCGTCACACTCGATCGCCGGCGCTGATACATTTGTCGGAGACGGTGGAGGAGACCCATTCGACAGCACTG
CGCATGTATATGACAGTCAGTTTTTCGTTGACACCAGGTTGCACAATCCAGTGCCAGGCGAGGGTCGCCTGCCAACCGACAACCTGCTTGCACGCGACGACCGTACGGCATGCACTTGGC
AAAGCTTCATCAATAACGAGGATAAAATGCGCTCTGCGTTCGCTGCCGCATTTTTGAAGATGTCTCTCCTCGGCCAGGACCAGTCTAAGCTTGTTGACTGTTCGGAGGTCATTCCTC
GTA
AGCTATGGCTTTCCTTAACTTTTTGTTCTCAAAGCTGACTGCCTACAATTAGATTCACCTGGACATGCACAGAATGCATTCTTCCCTGGAAATGCTACAATTAACGACGTCGACGCGGCT
TGCACTCAGTCACCGTTCCCGAGCTTGCCGCAGGACCCAGCTATCACCTCGCTCGCTACTAT
GTACGTATACGGTCATACCTCTCAGCCTTTTATTATTTAATAACTGATATTCTCCTGT
AGCAATGAATTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCAACAAGTTCTTTGCACTTCTAACGGTCCTCTCCATCTCCTATGCCGCACCTAACCCACAGCTTACACTTTGTCCTAATCTACATCTCGCTTCGAATGCGGCATGCTGCAAG
TTTTTCGACCTCCGGGACGACCTGCAAAATAACCTTTTTAGTAATACCTGTGGAGAACGGGTTCGTGAGGCGCTTCGACTGACCTTCCACGACGCTATCGCTTTCTCGCCGACGAAAGGC
GGTGGAGGAGCGGATGGCTCGATTATCACGTTTGCGAACACGGAACTCCAGTTTGCCGCAAATGGGGGCAATGGCGGTGTTGAGGAATTCGTCGCAACACTGACACCATTCGGCCCGAAG
CACAATGTTACTCCTGGGGACCTAATCCAGTTCGCGGGCATGCTCGGCATTACGAACTGCCCGGGCACACCGCGCGTTCAGTTCTTCGCGGGAAGACCAGACCCAGTTGCTGCTGCTCCT
GACGGCCTCGTCAACCTGCCAACAG
ATGATGTTGATACGATTCTTGCGCGCTTCAACGATGCTGGCTTTAGTGCGGATGAGCTCGTCGCCCTTCTTTCGTCACACTCGATCGCCGGCGCT
GATACATTTGTCGGAGACGGTGGAGGAGACCCATTCGACAGCACTGCGCATGTATATGACAGTCAGTTTTTCGTTGACACCAGGTTGCACAATCCAGTGCCAGGCGAGGGTCGCCTGCCA
ACCGACAACCTGCTTGCACGCGACGACCGTACGGCATGCACTTGGCAAAGCTTCATCAATAACGAGGATAAAATGCGCTCTGCGTTCGCTGCCGCATTTTTGAAGATGTCTCTCCTCGGC
CAGGACCAGTCTAAGCTTGTTGACTGTTCGGAGGTCATTCCTC
ATTCACCTGGACATGCACAGAATGCATTCTTCCCTGGAAATGCTACAATTAACGACGTCGACGCGGCTTGCACTCAG
TCACCGTTCCCGAGCTTGCCGCAGGACCCAGCTATCACCTCGCTCGCTACTAT
CAATGAATTCTAA

Retrieve as FASTA