Entry information : FmeMnP06 (MnP6-long)
Entry ID 9620
Creation 2011-10-14 (Christophe Dunand)
Last sequence changes 2011-10-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-22 (Catherine Mathe (Scipio))
Peroxidase information: FmeMnP06 (MnP6-long)
Name (synonym) FmeMnP06 (MnP6-long)
Class Manganese peroxidase    [Orthogroup: MnP003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Hymenochaetaceae Fomitiporia
Organism Fomitiporia mediterranea    [TaxId: 208960 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FmeMnP06
start..stop
S start..stop
FmeMnP05 629 0 1..369 1..368
FmeMnP02 575 0 2..369 1..369
FmeMnP11 542 0 2..369 1..368
FmeMnP10 529 0 2..369 1..368
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 670425..670532 108 N° 2 670074..670369 296 N° 3 669614..670007 394 N° 4 669381..669547 167
N° 5 669241..669317 77 N° 6 669087..669154 68  
complement(join(669087..669154,669241..669317,669381..669547,669614..670007,6700 74..670369,670425..670532))


exon

Literature and cross-references FmeMnP06 (MnP6-long)
DNA ref. JGI genome:   scaffold_6 (670532..669087)
Protein sequence: FmeMnP06 (MnP6-long)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   369 (351)
PWM (Da):   %s   38771.76 (37043.8)  
PI (pH):   %s   3.97 (3.94) Peptide Signal:   %s   cut: 19 range:19-369
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFKLAVTTVALAAIAGAANFRRVTCPDGNIASDEACCAFFALRDDLQQNLFDGECGEDVHESLRLTFHDAIGFSLSGALKGTGADGSMIIFKDIEPNFAANDGIDDSVNALSPFLTRHNVTAGDLIQFAGAVGTTNCPGAPRLQFLAGRPNATFPADDNTVPLPQSDVTTILSRMEDAGFSPAELIHLLASHTIARSDTLVPGHEAVPFDSTPFTFDTQVFVEVLLKGVGIPFGVNNTDGAEVDSPIPQSGEMRLQSDFALARDRTACEWQSMVNNQQLMMSNFQSAMAKLAVVGQDVSQLVDCSEVVPEATPPLGKPATFPAGTTQNDVEQACQATPFPTLSTAGPASLIPACPDGDTDLDDCPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCAAACTCGCAGTTACTACTGTTGCTCTCGCTGCCATCGCCGGTGCTGCCAACTTCAGGCGCGTTACGTGCCCTGACGGCAACATTGCCAGCGATGAGGCTGTCAGTCTCTCT
CCAAAATTTCCGTTACCAATGAACTTACGTTGGTATATACTAGTGCTGTGCGTTCTTCGCACTTCGCGATGACCTCCAGCAGAACCTCTTCGATGGCGAGTGTGGCGAAGATGTACATGA
GTCCTTGCGTCTCACTTTCCACGACGCAATTGGATTCTCGCTGTCTGGAGCCCTCAAGGGCACCGGAGCGGACGGTTCCATGATTATTTTCAAGGACATTGAACCAAACTTCGCCGCCAA
TGACGGAATTGACGACTCCGTCAACGCACTTTCGCCCTTCCTCACTCGCCACAACGTAACTGCAGGCGACCTTATCCAATTTGCGGGTGCCGTTGGAAC
GTAAGATTTCACAATATACAT
GTCTACCGATTTATCTTCGCTCATCGTCGGAATTATATAATTTAGGACGAACTGCCCTGGTGCACCTCGCCTGCAATTCCTCGCCGGACGTCCGAATGCAACTTTCCCAGCTGATGATAA
CACCGTTCCTCTGCCCCAGAGCGATGTGACGACTATCCTTTCCCGCATGGAGGATGCCGGTTTCTCTCCTGCTGAACTCATCCACTTGCTCGCGTCGCACACAATCGCGCGTTCCGACAC
GCTTGTTCCTGGTCACGAGGCCGTTCCATTCGACTCCACACCATTCACCTTCGACACTCAGGTCTTCGTTGAAGTCTTGCTCAAGGGAGTTGGTATTCCTTTCGGCGTTAACAACACTGA
TGGAGCCGAAGTCGACTCTCCCATCCCACAATCCGGAGAGATGCGTCTCCAGTCCGACTTTGCGCTCGCTCGTGACCAG
GTCTGTATTTCCCTACGTTCCCCCTTGAGTATCTCATCTGA
TTCGCGACTGTATCTTCTCTTATAGCGAACGGCTTGCGAGTGGCAGAGCATGGTCAACAATCAACAACTCATGATGTCCAACTTCCAAAGCGCCATGGCCAAACTAGCAGTTGTTGGCCA
AGACGTCAGCCAGCTCGTTGACTGCTCCGAAGTCGTACCCGAAGCGACGCCCCCCCTCGGCAAGCCCGCAAC
GTAAGTTGCCCTAACGTTATCGCACAGTCATCTCATTCACTAAATCAC
ATCATTCGTCGTTAGTTTCCCGGCTGGTACAACCCAAAACGACGTAGAACAAGCCTGCCAGGCCACACCATTCCCAACCCTCTCCACAGACGGTACGTCTATTATTCTTCCGTTCTTCCA
TATCAGGACCTGGAACAACACTTGACTTATCATTATTAAAATTCTTCAACTCGTACAGCCGGCCCTGCATCCTTGATCCCAGCTTGCCCAGATGGCGACACGGACCTCGACGACTGCCCG
TCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCAAACTCGCAGTTACTACTGTTGCTCTCGCTGCCATCGCCGGTGCTGCCAACTTCAGGCGCGTTACGTGCCCTGACGGCAACATTGCCAGCGATGAGGCTTGCTGTGCGTTC
TTCGCACTTCGCGATGACCTCCAGCAGAACCTCTTCGATGGCGAGTGTGGCGAAGATGTACATGAGTCCTTGCGTCTCACTTTCCACGACGCAATTGGATTCTCGCTGTCTGGAGCCCTC
AAGGGCACCGGAGCGGACGGTTCCATGATTATTTTCAAGGACATTGAACCAAACTTCGCCGCCAATGACGGAATTGACGACTCCGTCAACGCACTTTCGCCCTTCCTCACTCGCCACAAC
GTAACTGCAGGCGACCTTATCCAATTTGCGGGTGCCGTTGGAAC
GACGAACTGCCCTGGTGCACCTCGCCTGCAATTCCTCGCCGGACGTCCGAATGCAACTTTCCCAGCTGATGATAAC
ACCGTTCCTCTGCCCCAGAGCGATGTGACGACTATCCTTTCCCGCATGGAGGATGCCGGTTTCTCTCCTGCTGAACTCATCCACTTGCTCGCGTCGCACACAATCGCGCGTTCCGACACG
CTTGTTCCTGGTCACGAGGCCGTTCCATTCGACTCCACACCATTCACCTTCGACACTCAGGTCTTCGTTGAAGTCTTGCTCAAGGGAGTTGGTATTCCTTTCGGCGTTAACAACACTGAT
GGAGCCGAAGTCGACTCTCCCATCCCACAATCCGGAGAGATGCGTCTCCAGTCCGACTTTGCGCTCGCTCGTGACCAG
CGAACGGCTTGCGAGTGGCAGAGCATGGTCAACAATCAACAA
CTCATGATGTCCAACTTCCAAAGCGCCATGGCCAAACTAGCAGTTGTTGGCCAAGACGTCAGCCAGCTCGTTGACTGCTCCGAAGTCGTACCCGAAGCGACGCCCCCCCTCGGCAAGCCC
GCAAC
TTTCCCGGCTGGTACAACCCAAAACGACGTAGAACAAGCCTGCCAGGCCACACCATTCCCAACCCTCTCCACAGACGCCGGCCCTGCATCCTTGATCCCAGCTTGCCCAGATGGC
GACACGGACCTCGACGACTGCCCGTCTTAA

Retrieve as FASTA