Entry information : FmeMnP03 (MnP3-long)
Entry ID 9622
Creation 2011-10-14 (Christophe Dunand)
Last sequence changes 2011-10-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-22 (Catherine Mathe (Scipio))
Peroxidase information: FmeMnP03 (MnP3-long)
Name (synonym) FmeMnP03 (MnP3-long)
Class Manganese peroxidase    [Orthogroup: MnP003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Hymenochaetaceae Fomitiporia
Organism Fomitiporia mediterranea    [TaxId: 208960 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FmeMnP03
start..stop
S start..stop
FmeMnP07 603 0 21..371 20..371
FmeMnP05 516 0 18..371 17..368
FmeMnP06 500 5e-179 1..371 1..369
FmeMnP09 486 1e-173 21..369 20..369
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35772..35882 111 N° 2 35021..35716 696 N° 3 34799..34965 167 N° 4 34669..34742 74
N° 5 34538..34605 68  
complement(join(34538..34605,34669..34742,34799..34965,35021..35716,35772..35882 ))


exon

Literature and cross-references FmeMnP03 (MnP3-long)
DNA ref. JGI genome:   scaffold_6 (35882..34538)
Protein sequence: FmeMnP03 (MnP3-long)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   371 (352)
PWM (Da):   %s   39066.03 (37243.0)  
PI (pH):   %s   4.29 (4.25) Peptide Signal:   %s   cut: 20 range:20-371
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFKLVIPTVVALAALAGAAHIKRATCPDGNTASDEACCAFFALRDDLQQNLFQGECGEDVHESLRLTFHDGVSFSLTGQFAGGGADGSILLFSDIETNFAENAGTEDGTDALAPFLTRHLVSAGDLIQFAAAVGLTNCPGAPRLQFLAGRPNATAPAQDGAIPGPADTVDSILSRFADAGFTSAEVVHLLASHTVARSDTIIPGHEAVPFDSTPFNFDTQFFLETLLKGTGVPFGRMEPNITGGEVDSPLSAEGEMRLQSDFALARDFRTACEWQSMVDDQCLMVENFRNAMKKLSVVGQDTSKLVDCSDLIPEAKPATKEHATFPAGTCPKEIQQSCKAPFPRLAVPGQPTQIPQCPDGSLNPADCPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTAAGCTTGTGATCCCGACTGTCGTCGCTCTTGCAGCCCTTGCCGGGGCCGCACATATCAAACGCGCTACTTGCCCCGACGGCAATACTGCGTCAGATGAAGCTGTGCGTAAA
TCATTTTTACTTCGATCTCCTGACATTCTGATCATCGTGCCTTTAGTGCTGTGCTTTCTTCGCCCTACGCGATGATCTGCAACAGAACCTGTTTCAGGGAGAGTGCGGCGAAGACGTGCA
TGAATCTCTGCGCCTGACATTCCACGACGGCGTTAGTTTCTCGTTAACAGGACAGTTCGCGGGCGGTGGTGCCGATGGATCGATCCTGCTCTTCAGCGATATTGAAACTAACTTCGCTGA
GAATGCGGGCACTGAGGATGGCACTGATGCCCTTGCACCTTTCCTTACTCGACATCTCGTTTCAGCTGGTGACCTTATCCAGTTCGCTGCTGCTGTGGGCTTGACTAACTGCCCTGGCGC
ACCTCGTCTTCAATTCCTCGCTGGCCGGCCGAACGCAACGGCACCTGCCCAGGACGGTGCCATCCCGGGACCTGCTGACACTGTAGACAGCATTCTCTCCCGCTTTGCAGACGCTGGCTT
TACTTCCGCAGAAGTCGTTCATCTGCTGGCATCCCACACCGTTGCGCGTTCGGACACAATCATCCCAGGACATGAGGCTGTCCCGTTTGATAGCACACCCTTCAACTTTGATACACAGTT
CTTCCTTGAGACGCTGCTTAAGGGTACCGGTGTCCCCTTCGGTCGTATGGAGCCGAACATTACTGGTGGTGAGGTCGACTCTCCTCTGTCAGCAGAGGGTGAGATGCGTCTTCAATCTGA
CTTCGCCCTCGCTCGCGATTTC
GTACGTCACTGCCATTTTATTATTTTACGTGGAAGTATTGATTACTGCTTTTTAGCGCACGGCATGCGAATGGCAGAGTATGGTCGACGACCAATGTC
TCATGGTGGAAAACTTTAGGAATGCGATGAAGAAGCTTTCGGTAGTAGGACAAGACACGAGCAAGCTCGTTGACTGCTCCGATCTCATTCCAGAAGCAAAGCCTGCTACCAAAGAGCATG
CCAC
GTATGTCTCGCTTTCTAACCATCTTGATTTGGGTATAAATAGTTGTCCGCTTTCAGATTTCCCGCGGGTACGTGCCCTAAGGAGATTCAACAGTCTTGCAAGGCGCCTTTCCCGCG
CCTTGCCGTTGATC
GTGAGTGCTTGAATGCTCCCAGCCGAAGTTCATTTTACTTATGGTATATACGTTATTTTATAGCGGGCCAGCCGACTCAGATTCCGCAGTGCCCTGACGGCTCCCT
CAACCCTGCTGACTGCCCATCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTAAGCTTGTGATCCCGACTGTCGTCGCTCTTGCAGCCCTTGCCGGGGCCGCACATATCAAACGCGCTACTTGCCCCGACGGCAATACTGCGTCAGATGAAGCTTGCTGTGCT
TTCTTCGCCCTACGCGATGATCTGCAACAGAACCTGTTTCAGGGAGAGTGCGGCGAAGACGTGCATGAATCTCTGCGCCTGACATTCCACGACGGCGTTAGTTTCTCGTTAACAGGACAG
TTCGCGGGCGGTGGTGCCGATGGATCGATCCTGCTCTTCAGCGATATTGAAACTAACTTCGCTGAGAATGCGGGCACTGAGGATGGCACTGATGCCCTTGCACCTTTCCTTACTCGACAT
CTCGTTTCAGCTGGTGACCTTATCCAGTTCGCTGCTGCTGTGGGCTTGACTAACTGCCCTGGCGCACCTCGTCTTCAATTCCTCGCTGGCCGGCCGAACGCAACGGCACCTGCCCAGGAC
GGTGCCATCCCGGGACCTGCTGACACTGTAGACAGCATTCTCTCCCGCTTTGCAGACGCTGGCTTTACTTCCGCAGAAGTCGTTCATCTGCTGGCATCCCACACCGTTGCGCGTTCGGAC
ACAATCATCCCAGGACATGAGGCTGTCCCGTTTGATAGCACACCCTTCAACTTTGATACACAGTTCTTCCTTGAGACGCTGCTTAAGGGTACCGGTGTCCCCTTCGGTCGTATGGAGCCG
AACATTACTGGTGGTGAGGTCGACTCTCCTCTGTCAGCAGAGGGTGAGATGCGTCTTCAATCTGACTTCGCCCTCGCTCGCGATTTC
CGCACGGCATGCGAATGGCAGAGTATGGTCGAC
GACCAATGTCTCATGGTGGAAAACTTTAGGAATGCGATGAAGAAGCTTTCGGTAGTAGGACAAGACACGAGCAAGCTCGTTGACTGCTCCGATCTCATTCCAGAAGCAAAGCCTGCTACC
AAAGAGCATGCCAC
ATTTCCCGCGGGTACGTGCCCTAAGGAGATTCAACAGTCTTGCAAGGCGCCTTTCCCGCGCCTTGCCGTTGATCCGGGCCAGCCGACTCAGATTCCGCAGTGCCCT
GACGGCTCCCTCAACCCTGCTGACTGCCCATCTTAA

Retrieve as FASTA