Entry information : FmeMnP07 (MnP7-long)
Entry ID 9623
Creation 2011-10-14 (Christophe Dunand)
Last sequence changes 2011-10-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-22 (Catherine Mathe (Scipio))
Peroxidase information: FmeMnP07 (MnP7-long)
Name (synonym) FmeMnP07 (MnP7-long)
Class Manganese peroxidase    [Orthogroup: MnP003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Hymenochaetaceae Fomitiporia
Organism Fomitiporia mediterranea    [TaxId: 208960 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FmeMnP07
start..stop
S start..stop
FmeMnP03 611 0 1..371 1..371
FmeMnP05 539 0 1..371 1..368
FmeMnP02 511 0 2..371 1..369
FmeMnP06 510 0 1..371 1..369
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 29022..29132 111 N° 2 29193..29888 696 N° 3 29946..30112 167 N° 4 30175..30248 74
N° 5 30316..30383 68  
join(29022..29132,29193..29888,29946..30112,30175..30248,30316..30383)


exon

Literature and cross-references FmeMnP07 (MnP7-long)
DNA ref. JGI genome:   scaffold_6 (29022..30383)
Protein sequence: FmeMnP07 (MnP7-long)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   371 (353)
PWM (Da):   %s   39457.35 (37703.3)  
PI (pH):   %s   4.31 (4.27) Peptide Signal:   %s   cut: 19 range:19-371
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFKLVIATVALVAVAGAANYKRVTCPDGVNTATNEACCAFFSLRDDLQNNLFEGECSEDVHESLRLTFHDGVSFSLSGKFAGGGADGSILLFRDIETNFTENAGTDDGADALAPFLTRHLVSAGDLIQFAAAVGITNCPGAPRLQFLVGRPNATAPAQDGAIPGPADSVDTILSRFADAGFTTAEVIHLLASHTVARSDTIVPDHQAVPFDSTPFDFDTQFFLETLLKGTAVPFNRTEPNTAGGEVDSPLAAEGEMRLQSDFALARDQRTACEWQSMVDNQRLMMENFRTAMMKLSNVGQDTSKLVDCSELIPVPKPAVKLHATFPAGTSRNEVQQSCPLPFPVLRTPGQATQIPECPNGDLNLADCPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCAAGCTTGTCATTGCTACTGTTGCTCTCGTTGCTGTCGCTGGCGCTGCCAACTACAAGCGTGTCACTTGCCCCGACGGGGTTAATACTGCAACAAATGAAGCAGTTCGTATC
TCTGACAATTAGTCTTGTCCTATCCCGCTAACTAGCCAAATGTTTATTTAGTGTTGCGCTTTCTTCTCTCTCCGCGATGACTTGCAGAACAACCTGTTCGAGGGAGAGTGTAGCGAGGAC
GTACATGAGTCCCTGCGCCTGACGTTCCACGATGGTGTCAGTTTCTCGCTGTCAGGCAAATTTGCGGGTGGCGGAGCAGACGGCTCGATTCTCCTCTTCCGTGACATCGAGACCAACTTT
ACTGAGAATGCAGGTACTGACGATGGTGCTGATGCTCTCGCGCCATTCCTTACTCGTCACCTCGTCTCTGCTGGCGACCTTATCCAGTTTGCTGCTGCTGTCGGCATAACAAATTGCCCT
GGCGCCCCTCGTCTTCAGTTCCTCGTCGGCCGCCCTAACGCAACGGCTCCTGCTCAAGACGGTGCCATTCCAGGACCGGCTGACTCTGTGGATACCATTCTCTCCCGTTTCGCCGACGCG
GGCTTCACGACTGCAGAAGTTATACACTTGCTTGCATCTCACACTGTAGCTCGCTCGGACACGATTGTCCCAGATCATCAGGCGGTTCCCTTCGACAGCACGCCATTCGACTTCGACACA
CAGTTCTTCCTCGAGACTCTGCTTAAGGGAACTGCCGTCCCGTTCAACCGCACGGAACCCAACACAGCCGGGGGTGAAGTCGACTCTCCTCTTGCTGCTGAAGGCGAGATGCGTCTGCAA
TCCGACTTTGCTCTTGCTCGTGACCAG
GTAAATTTCTATTATTACGAGAGTTTTAATTCAACATGCTAATCGTCATTACTAAAGCGTACGGCCTGCGAATGGCAGAGCATGGTTGACAAC
CAACGTCTCATGATGGAGAATTTCAGGACCGCGATGATGAAGCTCTCGAATGTCGGACAGGACACAAGCAAACTCGTTGACTGTTCCGAACTCATCCCCGTCCCGAAGCCGGCCGTGAAG
TTGCACGCCAC
GTACGTGTTGCTTCATGTTCTACTTCATAAATCACTACTAACGGTTAGTTCCGCGTCACCAGCTTCCCTGCAGGCACAAGTCGCAATGAAGTCCAGCAGTCATGCCCGT
TGCCGTTCCCAGTCCTCCGTACCGATC
GTACGTGTTTTCCCATCCCTTATGAGTGATGACTATTCCGTTTACAAGCTGTGTACCGCTCCTTTAGCCGGCCAGGCCACTCAGATTCCAGAG
TGCCCGAACGGCGACCTCAACCTTGCTGACTGCCCGTCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCAAGCTTGTCATTGCTACTGTTGCTCTCGTTGCTGTCGCTGGCGCTGCCAACTACAAGCGTGTCACTTGCCCCGACGGGGTTAATACTGCAACAAATGAAGCATGTTGCGCT
TTCTTCTCTCTCCGCGATGACTTGCAGAACAACCTGTTCGAGGGAGAGTGTAGCGAGGACGTACATGAGTCCCTGCGCCTGACGTTCCACGATGGTGTCAGTTTCTCGCTGTCAGGCAAA
TTTGCGGGTGGCGGAGCAGACGGCTCGATTCTCCTCTTCCGTGACATCGAGACCAACTTTACTGAGAATGCAGGTACTGACGATGGTGCTGATGCTCTCGCGCCATTCCTTACTCGTCAC
CTCGTCTCTGCTGGCGACCTTATCCAGTTTGCTGCTGCTGTCGGCATAACAAATTGCCCTGGCGCCCCTCGTCTTCAGTTCCTCGTCGGCCGCCCTAACGCAACGGCTCCTGCTCAAGAC
GGTGCCATTCCAGGACCGGCTGACTCTGTGGATACCATTCTCTCCCGTTTCGCCGACGCGGGCTTCACGACTGCAGAAGTTATACACTTGCTTGCATCTCACACTGTAGCTCGCTCGGAC
ACGATTGTCCCAGATCATCAGGCGGTTCCCTTCGACAGCACGCCATTCGACTTCGACACACAGTTCTTCCTCGAGACTCTGCTTAAGGGAACTGCCGTCCCGTTCAACCGCACGGAACCC
AACACAGCCGGGGGTGAAGTCGACTCTCCTCTTGCTGCTGAAGGCGAGATGCGTCTGCAATCCGACTTTGCTCTTGCTCGTGACCAG
CGTACGGCCTGCGAATGGCAGAGCATGGTTGAC
AACCAACGTCTCATGATGGAGAATTTCAGGACCGCGATGATGAAGCTCTCGAATGTCGGACAGGACACAAGCAAACTCGTTGACTGTTCCGAACTCATCCCCGTCCCGAAGCCGGCCGTG
AAGTTGCACGCCAC
CTTCCCTGCAGGCACAAGTCGCAATGAAGTCCAGCAGTCATGCCCGTTGCCGTTCCCAGTCCTCCGTACCGATCCCGGCCAGGCCACTCAGATTCCAGAGTGCCCG
AACGGCGACCTCAACCTTGCTGACTGCCCGTCCTAA

Retrieve as FASTA