Entry information : SturCcP
Entry ID 9627
Creation 2011-10-24 (Christophe Dunand)
Last sequence changes 2012-07-18 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: SturCcP
Name SturCcP
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Setosphaeria
Organism Setosphaeria turcica    [TaxId: 93612 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SturCcP
start..stop
S start..stop
PtritCcP 719 0 1..373 1..374
CheCcP_C4 717 0 1..373 1..373
PterCcP01 714 0 1..373 1..374
COsaCcP 712 0 1..373 1..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3953449..3953858 410 N° 2 3953917..3954625 709  
join(3953449..3953858,3953917..3954625)


exon

Literature and cross-references SturCcP
DNA ref. JGI genome:   scaffold_1 (3953449..3954625)
Cluster/Prediction ref. JGI gene:   85397
Protein sequence: SturCcP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   374
PWM (Da):   %s   41788.51  
PI (pH):   %s   8.27
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASASRSFSRALRTAAPSFRTTATRSPARFVAPAQNAFRSQRRGYASQEDGPDKHEGNPTGLAWGAGALLLGAGVYSLYTYKPELFGQASTKVFTPRFEDYQKVYDEIAKRLQEFDEYDDGSYGPVLLRLAWHASGTYDKQTGTGGSNGATMRFAPESDHGANAGLKAARDFLEPVKQAFPWITYSDLWILGGVCAIQEMQGPKIPYRAGRNDRDVSFCTPDGRLPDASKDGSHIRAIFGRMGFDDRAMVALSGAHALGRCHTDRSGYDGPWTFSPTTLTNDYYKLLLEEKWQYKKWNGPKQFEDVKTKSLMMLPTDMELVKDKGFRQYTNLYAKDNDAFFKDFADAVCTLFELGVPFQHPEDQRWVFKSSFD*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCGGCCTCTCGCAGCTTCTCTCGCGCCCTGCGCACCGCGGCGCCTTCCTTCCGCACCACCGCCACCCGCTCCCCTGCCCGCTTTGTCGCTCCCGCACAGAATGCCTTCCGCAGC
CAGCGCCGCGGATATGCCTCGCAGGAAGACGGCCCTGACAAGCACGAGGGAAACCCCACGGGCCTAGCCTGGGGTGCCGGCGCTCTGCTTCTCGGTGCTGGTGTCTACAGCCTCTACACG
TACAAGCCCGAGTTGTTCGGCCAGGCCAGCACCAAGGTCTTCACCCCCCGATTTGAGGACTACCAGAAGGTCTACGACGAGATTGCCAAGCGGCTGCAGGAGTTCGACGAGTACGACGAC
GGCAGCTACGGCCCTGTGCTGCTGCGTTTGGCATGGCACGCTTCGGGAAC
GTGAGTACATGCAACGGTTCCTTTTCCCCCCCCAGGACACAAAACTCACACTTTACAGCTACGACAAGCA
GACTGGCACTGGTGGCTCCAACGGCGCCACCATGCGCTTTGCCCCCGAGAGTGACCACGGTGCCAATGCTGGTCTCAAGGCTGCCCGTGACTTCCTCGAGCCCGTCAAGCAGGCTTTCCC
ATGGATCACCTACTCCGACCTGTGGATCCTCGGCGGTGTCTGCGCCATCCAAGAGATGCAGGGCCCCAAGATTCCTTACCGCGCTGGCCGCAACGACCGTGACGTCTCCTTCTGCACGCC
CGACGGCCGCTTGCCCGATGCCAGCAAGGATGGCAGCCACATCCGTGCCATCTTTGGTCGTATGGGCTTCGATGATCGTGCCATGGTTGCTCTGTCTGGTGCCCACGCCCTCGGCCGCTG
CCACACTGACCGCTCGGGCTACGACGGTCCCTGGACCTTCTCCCCAACTACCCTGACCAACGACTACTACAAGCTCCTCCTAGAGGAGAAGTGGCAGTACAAGAAGTGGAACGGCCCCAA
GCAGTTTGAGGATGTCAAGACCAAGAGCCTCATGATGCTGCCCACAGACATGGAGCTTGTCAAGGACAAGGGCTTCAGGCAATACACCAACTTGTATGCCAAGGACAACGATGCTTTCTT
CAAGGACTTTGCCGACGCAGTTTGCACACTGTTCGAGCTTGGTGTGCCATTCCAGCACCCAGAGGACCAGCGATGGGTCTTCAAGAGCTCTTTTGAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCGGCCTCTCGCAGCTTCTCTCGCGCCCTGCGCACCGCGGCGCCTTCCTTCCGCACCACCGCCACCCGCTCCCCTGCCCGCTTTGTCGCTCCCGCACAGAATGCCTTCCGCAGC
CAGCGCCGCGGATATGCCTCGCAGGAAGACGGCCCTGACAAGCACGAGGGAAACCCCACGGGCCTAGCCTGGGGTGCCGGCGCTCTGCTTCTCGGTGCTGGTGTCTACAGCCTCTACACG
TACAAGCCCGAGTTGTTCGGCCAGGCCAGCACCAAGGTCTTCACCCCCCGATTTGAGGACTACCAGAAGGTCTACGACGAGATTGCCAAGCGGCTGCAGGAGTTCGACGAGTACGACGAC
GGCAGCTACGGCCCTGTGCTGCTGCGTTTGGCATGGCACGCTTCGGGAAC
CTACGACAAGCAGACTGGCACTGGTGGCTCCAACGGCGCCACCATGCGCTTTGCCCCCGAGAGTGACCAC
GGTGCCAATGCTGGTCTCAAGGCTGCCCGTGACTTCCTCGAGCCCGTCAAGCAGGCTTTCCCATGGATCACCTACTCCGACCTGTGGATCCTCGGCGGTGTCTGCGCCATCCAAGAGATG
CAGGGCCCCAAGATTCCTTACCGCGCTGGCCGCAACGACCGTGACGTCTCCTTCTGCACGCCCGACGGCCGCTTGCCCGATGCCAGCAAGGATGGCAGCCACATCCGTGCCATCTTTGGT
CGTATGGGCTTCGATGATCGTGCCATGGTTGCTCTGTCTGGTGCCCACGCCCTCGGCCGCTGCCACACTGACCGCTCGGGCTACGACGGTCCCTGGACCTTCTCCCCAACTACCCTGACC
AACGACTACTACAAGCTCCTCCTAGAGGAGAAGTGGCAGTACAAGAAGTGGAACGGCCCCAAGCAGTTTGAGGATGTCAAGACCAAGAGCCTCATGATGCTGCCCACAGACATGGAGCTT
GTCAAGGACAAGGGCTTCAGGCAATACACCAACTTGTATGCCAAGGACAACGATGCTTTCTTCAAGGACTTTGCCGACGCAGTTTGCACACTGTTCGAGCTTGGTGTGCCATTCCAGCAC
CCAGAGGACCAGCGATGGGTCTTCAAGAGCTCTTTTGAC

Retrieve as FASTA