Entry information : PbreLiP04 (LiP4)
Entry ID 9631
Creation 2011-10-24 (Christophe Dunand)
Last sequence changes 2011-10-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Catherine Mathe (Scipio))
Peroxidase information: PbreLiP04 (LiP4)
Name (synonym) PbreLiP04 (LiP4)
Class Lignin peroxidase    [Orthogroup: LiP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phlebia
Organism Phlebia brevispora    [TaxId: 194682 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PbreLiP04
start..stop
S start..stop
PbreLiP03 582 0 1..362 1..362
PrLiP01 573 0 1..370 1..370
BaLiP04 501 1e-179 1..362 1..362
TvLiP09 482 4e-172 1..362 1..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 747351..747411 61 N° 2 747466..747673 208 N° 3 747724..747858 135 N° 4 747920..747987 68
N° 5 748046..748057 12 N° 6 748111..748152 42 N° 7 748205..748283 79 N° 8 748336..748531 196
N° 9 748583..748628 46 N° 10 748683..748855 173 N° 11 748906..748970 65 N° 12 749032..749059 28
join(747351..747411,747466..747673,747724..747858,747920..747987,748046..748057, 748111..748152,748205..748283,748336..748531,748583..748628,748683..748855,74890 6..748970,749032..749059)


exon

Literature and cross-references PbreLiP04 (LiP4)
DNA ref. JGI genome:   scaffold_14 (747351..749059)
Protein sequence: PbreLiP04 (LiP4)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   370 (349)
PWM (Da):   %s   39223.44 (37002.2)  
PI (pH):   %s   4.26 (4.22) Peptide Signal:   %s   cut: 22 range:22-370
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFKQLLVCITTALVIGFANAALTRRVACPDGVNTATNAACCGLFAVRDDLNENLFNGGQCNDEAREALRLTFHDPIAISPALEAQGQFGGGGADGSIVIFADTETGFPANIGLDEVIEIQKPFLQRSNMSVADFIQFAGAAAVSNCPGAPALPVFGRQDATQPAPDGLVPEPFDLIDDVLARFADAGGFDELETVWFLIAHTVAAQGDVGPTIPRTPFDSTPELFDGQFFIETQLRGTTFPGKSGIQGTVMSPLKGEFRLQTDHLARDSRTACEWQSFGTDQAKLQNRFQFIFGAMGQLGHDPDGLIDCSEVLPNPPPLTTTPHFPAGKTNKDVEQCAETPFPTLRTNPGPQTAVAPVPSSPVRNA

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTCAAGCAGCTTCTCGTCTGCATTACTACAGCTCTCGTCATCGGCTTTGCTAATGGTTAGTCTTGATATCATTCACCACTTTGCACTACTCATTGTCTGTTTTCACTAGCTGCG
CTTACCCGCCGCGTAGCATGTCCTGATGGTGTCAACACAGCTACAAACGCTGCCTGCTGCGGTCTCTTCGCTGTTCGTGACGACCTGAACGAGAACCTCTTCAACGGCGGTCAGTGTAAT
GACGAAGCACGCGAGGCCTTGCGCCTTACGTTCCACGATCCTATCGCTATCTCACCAGCCCTGGAGGCGCAGGGTCAATTTGG
GTAAGCATCTCTATTTCTGTCATGGCCACAACTGATC
AACATCGTGCTAGCGGTGGAGGTGCCGACGGATCGATCGTCATCTTTGCAGATACTGAGACAGGTTTCCCGGCTAACATTGGTCTCGACGAAGTAATTGAGATCCAGAAGCCGTTCCTAC
AGCGGAGCAACATGTCCGTTGCCGACTT
GTACGTTGCTCTTTACCTATAATTTTCGACAACAAAGATGTCCTGATACATCGGCAAATAGCATCCAATTTGCTGGCGCAGCCGCTGTTTCC
AACTGCCCCGGTGCACCCGCACTTCCTGTATTCGTCG
GTACGTTCGCTCCGTACAGCGTCGCCCGATTAAACTTGATTATTAATCTGCTGTATAGGACGCCAGGATGGTATGCAAAATAT
GCAATCGAGTATCCGAGTATTCATGCTTTTATTTCAACAGCTACTCAGCCCGCCCCTGATGGACTGGTGCCTGAGCCATTTGGTGACTTCAACGCTTTAGGACCATGTTGACGAGACTAA
CTGAGCATGTTTAGACCTCATCGACGACGTTCTTGCCCGCTTTGCTGACGCTGGAGGTTTTGATGAACTGGAGACCGTTTGGTTCTTAATTGCGTAAGAGTGTTGAATGGAGTATTGAGA
TTCAGCATTAACCCTTCGACTCTAGGCATACTGTTGCGGCCCAGGGCGACGTCGGACCGACCATTCCGCGTACTCCGTTCGATTCTACCCCTGAGCTCTTCGATGGTCAATTCTTCATCG
AGACTCAGCTGCGCGGTACCACGTTCCCCGGCAAGTCTGGTATTCAAGGTACTGTCATGTCGCCGCTGAAGGGTGAATTCCGTCTTCAAACCGATCATTTG
GTATGTATTACGTGCTTTT
AATGTCATGCCATATCTCACATACTTTGATAGCTGGCTCGCGACTCCAGGACCGCGTGCGAATGGCAGTCGTTTGGTAGTAAGTCGCCATTGCTGATTTCTCGAGGTGTGTTTACTGATG
TTCCTGGTTTAGCCGACCAGGCCAAATTGCAGAACCGGTTCCAGTTCATCTTCGGAGCCATGGGTCAGCTCGGCCACGATCCTGACGGCCTTATCGACTGCAGCGAAGTCCTCCCGAACC
CGCCGCCGTTGACGACCACTCCTCACTTCCCTGCGGGCAAGACCAACAAAGACGTTGAACAGGCT
GTACGTAAAGTTCATCCGTGTTCCAGCTATGTGCTGACAGAAATCATCAGTGCGC
GGAAACTCCCTTCCCGACCCTAAGGACTAATCCTGGGCCTCAGACCGCTGTTGCCCCAGT
GTAAGTGGTTTTCGTCACCATCCCTATTTGAACGTTGGCCGTGCTCACATTCGCTCCCTA
GGCCGTCGTCTCCGGTTCGGAACGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTCAAGCAGCTTCTCGTCTGCATTACTACAGCTCTCGTCATCGGCTTTGCTAATGCTGCGCTTACCCGCCGCGTAGCATGTCCTGATGGTGTCAACACAGCTACAAACGCTGCC
TGCTGCGGTCTCTTCGCTGTTCGTGACGACCTGAACGAGAACCTCTTCAACGGCGGTCAGTGTAATGACGAAGCACGCGAGGCCTTGCGCCTTACGTTCCACGATCCTATCGCTATCTCA
CCAGCCCTGGAGGCGCAGGGTCAATTTGG
CGGTGGAGGTGCCGACGGATCGATCGTCATCTTTGCAGATACTGAGACAGGTTTCCCGGCTAACATTGGTCTCGACGAAGTAATTGAGATC
CAGAAGCCGTTCCTACAGCGGAGCAACATGTCCGTTGCCGACTT
CATCCAATTTGCTGGCGCAGCCGCTGTTTCCAACTGCCCCGGTGCACCCGCACTTCCTGTATTCGTCGGACGCCAG
GATG
CTACTCAGCCCGCCCCTGATGGACTGGTGCCTGAGCCATTTGACCTCATCGACGACGTTCTTGCCCGCTTTGCTGACGCTGGAGGTTTTGATGAACTGGAGACCGTTTGGTTCTTA
ATTGC
GCATACTGTTGCGGCCCAGGGCGACGTCGGACCGACCATTCCGCGTACTCCGTTCGATTCTACCCCTGAGCTCTTCGATGGTCAATTCTTCATCGAGACTCAGCTGCGCGGTACC
ACGTTCCCCGGCAAGTCTGGTATTCAAGGTACTGTCATGTCGCCGCTGAAGGGTGAATTCCGTCTTCAAACCGATCATTTG
CTGGCTCGCGACTCCAGGACCGCGTGCGAATGGCAGTCG
TTTGGTA
CCGACCAGGCCAAATTGCAGAACCGGTTCCAGTTCATCTTCGGAGCCATGGGTCAGCTCGGCCACGATCCTGACGGCCTTATCGACTGCAGCGAAGTCCTCCCGAACCCGCCG
CCGTTGACGACCACTCCTCACTTCCCTGCGGGCAAGACCAACAAAGACGTTGAACAGGCT
TGCGCGGAAACTCCCTTCCCGACCCTAAGGACTAATCCTGGGCCTCAGACCGCTGTTGCC
CCAGT
GCCGTCGTCTCCGGTTCGGAACGCTTGA

Retrieve as FASTA