Entry information : ManiCIIAA01
Entry ID 9634
Creation 2011-10-27 (Christophe Dunand)
Last sequence changes 2011-10-27 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2013-06-04 (Nizar Fawal)
Peroxidase information: ManiCIIAA01
Name ManiCIIAA01
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Clavicipitaceae Metarhizium
Organism Metarhizium anisopliae    [TaxId: 5530 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ManiCIIAA01
start..stop
S start..stop
MacrCIIAA 760 0 1..388 1..388
VaaCIIAA02 413 7e-144 1..371 1..377
VdaCIIAA02 401 2e-139 1..371 1..377
MEspCIIAA02_NRRL54901 402 3e-139 1..360 1..367
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 310960..311518 559 N° 2 311617..312026 410 N° 3 312131..312328 198  
join(310960..311518,311617..312026,312131..312328)


exon

Literature and cross-references ManiCIIAA01
Literature Gao,Q. et al., Genome Sequencing and Comparative Transcriptomics of the Model Entomopathogenic Fungi Metarhizium anisopliae and M. acridum. PLoS Genet. 7 (1), E1001264 (2011)
DNA ref. GenBank:   GL698719.1 (310960..312328)
Protein sequence: ManiCIIAA01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   388 (372)
PWM (Da):   %s   41460.94 (39812.1)  
PI (pH):   %s   4.84 (4.75) Peptide Signal:   %s   cut: 17 range:17-388
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKATLVIFSAISMANAFPGMSELRHVSRAQDEDNTKKLPGDLEGQDESTMSETGKLIKNILQGNENPQDLTTAYSSVPDQNSAECKADKCCIWKHIADEMKSKMTGDAGRCNNLARQCIRMGFHDAATWSLNTGKDGGADGSLVLARECFDRKINNGLTDGCNQMQAWFDTYKSFGVSMADLIQMGANVATVVCPLGPRVRSFVGRKDNANPSPDGLLPSPSDPADQLISLFANKTISANQLVALVGAHTTSQQFFVDTARAGDPQDSTPGVWDTNFYGETTDANSPKQVFKFQSDVSLSQDSRTKGAWTAFTGTQGQRPWNAYAAAYVRMSMLGVYNTNDLTECTKALPLPITSFTSPDAAALADFANGGAPDASRNASNGDIIVV*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Strain="ARSEF 23".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGCCACTCTTGTAATATTCTCTGCCATCTCCATGGCCAATGCCTTTCCAGGCATGTCCGAACTCCGGCATGTATCCCGTGCGCAAGATGAGGACAATACCAAGAAACTACCTGGT
GACTTGGAGGGTCAAGACGAGAGCACCATGTCTGAGACAGGGAAGCTCATTAAGAATATCTTGCAAGGCAACGAAAATCCTCAAGACCTGACCACGGCGTATTCTTCGGTTCCGGACCAA
AACTCAGCCGAGTGCAAGGCTGACAAGTGTTGCATATGGAAGCACATTGCGGATGAGATGAAGTCCAAGATGACGGGGGATGCCGGACGTTGCAACAACCTTGCAAGACAATGCATTCGC
ATGGGATTCCACGACGCAGCAACGTGGTCTTTAAACACGGGCAAGGACGGCGGCGCGGACGGGTCATTAGTTCTAGCCAGAGAATGCTTTGACCGCAAGATCAACAACGGCTTGACAGAC
GGATGCAACCAGATGCAGGCTTGGTTCGACACGTACAAGTCCTTTGGCGTCAGCATGGCCGATCTGATCCAGATGGGCG
GTACGTTTTGCACATTGCCCTCCCATGACCTGGTTTCCCAG
GCGGTCCAGAGATGAGAGTAGTCGCGCTTCTTGCTAACATCTCAACTGGTCCTTTAGCAAATGTCGCCACGGTTGTCTGCCCCCTCGGCCCCCGAGTCCGCAGCTTCGTCGGGCGCAAAG
ACAACGCCAACCCATCGCCAGACGGCCTCCTGCCATCGCCGTCCGACCCGGCCGACCAGCTGATTTCTCTCTTTGCCAACAAGACCATCAGCGCCAACCAGCTCGTGGCCCTGGTCGGCG
CGCACACCACCAGCCAGCAGTTCTTTGTAGACACCGCCCGCGCTGGAGACCCCCAGGACAGCACCCCCGGTGTATGGGACACCAACTTTTACGGAGAGACCACCGACGCCAATTCGCCCA
AGCAGGTGTTCAAGTTTCAAAGCGATGTTAGTCTATCGCAAGATTCTAGGACCAAGGGTGCCTGGACGGCGTTTACCGGGACACAGGGACAGCGTCCTTGGAACGGG
GTATGTGAGACCA
AAGAAAGAAAGAAAAGAGCTGTTTGCTTTTGAGCTCGTGGTAGAAGTAGTACACACTTGATGGATTTGATATTCTGACAATTTCATACTAGGCCTACGCCGCGGCGTACGTTCGCATGAG
CATGCTGGGCGTGTATAATACCAATGACTTGACCGAGTGCACAAAGGCGCTCCCGCTGCCCATCACTTCCTTCACGTCCCCCGACGCCGCGGCCTTGGCGGACTTTGCCAACGGCGGGGC
GCCTGATGCCTCCAGAAACGCGTCCAATGGAGATATTATTGTAGTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGCCACTCTTGTAATATTCTCTGCCATCTCCATGGCCAATGCCTTTCCAGGCATGTCCGAACTCCGGCATGTATCCCGTGCGCAAGATGAGGACAATACCAAGAAACTACCTGGT
GACTTGGAGGGTCAAGACGAGAGCACCATGTCTGAGACAGGGAAGCTCATTAAGAATATCTTGCAAGGCAACGAAAATCCTCAAGACCTGACCACGGCGTATTCTTCGGTTCCGGACCAA
AACTCAGCCGAGTGCAAGGCTGACAAGTGTTGCATATGGAAGCACATTGCGGATGAGATGAAGTCCAAGATGACGGGGGATGCCGGACGTTGCAACAACCTTGCAAGACAATGCATTCGC
ATGGGATTCCACGACGCAGCAACGTGGTCTTTAAACACGGGCAAGGACGGCGGCGCGGACGGGTCATTAGTTCTAGCCAGAGAATGCTTTGACCGCAAGATCAACAACGGCTTGACAGAC
GGATGCAACCAGATGCAGGCTTGGTTCGACACGTACAAGTCCTTTGGCGTCAGCATGGCCGATCTGATCCAGATGGGCG
CAAATGTCGCCACGGTTGTCTGCCCCCTCGGCCCCCGAGTC
CGCAGCTTCGTCGGGCGCAAAGACAACGCCAACCCATCGCCAGACGGCCTCCTGCCATCGCCGTCCGACCCGGCCGACCAGCTGATTTCTCTCTTTGCCAACAAGACCATCAGCGCCAAC
CAGCTCGTGGCCCTGGTCGGCGCGCACACCACCAGCCAGCAGTTCTTTGTAGACACCGCCCGCGCTGGAGACCCCCAGGACAGCACCCCCGGTGTATGGGACACCAACTTTTACGGAGAG
ACCACCGACGCCAATTCGCCCAAGCAGGTGTTCAAGTTTCAAAGCGATGTTAGTCTATCGCAAGATTCTAGGACCAAGGGTGCCTGGACGGCGTTTACCGGGACACAGGGACAGCGTCCT
TGGAACGGG
GCCTACGCCGCGGCGTACGTTCGCATGAGCATGCTGGGCGTGTATAATACCAATGACTTGACCGAGTGCACAAAGGCGCTCCCGCTGCCCATCACTTCCTTCACGTCCCCC
GACGCCGCGGCCTTGGCGGACTTTGCCAACGGCGGGGCGCCTGATGCCTCCAGAAACGCGTCCAATGGAGATATTATTGTAGTCTAG

Retrieve as FASTA