Entry information : MacrCIIAA
Entry ID 9635
Creation 2011-10-27 (Christophe Dunand)
Last sequence changes 2011-10-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-10-27 (Christophe Dunand)
Peroxidase information: MacrCIIAA
Name MacrCIIAA
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Clavicipitaceae Metarhizium
Organism Metarhizium acridum    [TaxId: 92637 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MacrCIIAA
start..stop
S start..stop
ManiCIIAA01 760 0 1..388 1..388
VaaCIIAA02 409 2e-142 1..371 1..377
VdaCIIAA02 400 4e-139 1..379 1..387
MEspCIIAA02_NRRL54901 397 2e-137 10..360 13..367
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 159433..159991 559 N° 2 160093..160502 410 N° 3 160632..160829 198  
join(159433..159991,160093..160502,160632..160829)


exon

Literature and cross-references MacrCIIAA
DNA ref. GenBank:   GL698519.1 (159433..160829) [Incorrect splicing]
Protein sequence: MacrCIIAA
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   388 (372)
PWM (Da):   %s   41345.84 (39761.0)  
PI (pH):   %s   4.76 (4.68) Peptide Signal:   %s   cut: 17 range:17-388
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKAALVILSAISMANAFPGMSDLRHVRRAQDEENTKKLPGDLEGQDESTMSETGKLIKNILQGNETPQDLTTAYSSVPDQNSAECKADKCCIWKHIADEMKSKMTGDAGRCNNLARQCIRMGFHDAATWSLDTGKDGGADGSLVLARECFDRQVNNGVTDGCNQMQAWFDTYKSFGVSMADLIQMGANVATVVCPLGPRVRSFVGRKDNSNPSPDGLLPSAFDSADQLISLFANKTISASQLVALVGAHTTSQQFFVDANRAGDPQDSTPGVWDTNFYGETTDASSPKQVFKFQSDINLSQDSRATGAWTAFTGTHGQRPWNAYAAAYVRMSMLGVYNTNDLTECTKALPLPITSFSSPDAAALADFANGGAPDAAKNASNGDVIVV*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGCCGCTCTTGTAATACTCTCGGCCATCTCCATGGCGAATGCCTTTCCGGGCATGTCCGACCTCCGGCATGTACGCCGTGCGCAAGACGAGGAGAATACCAAGAAACTACCTGGG
GACTTGGAGGGTCAAGACGAAAGCACCATGTCTGAGACTGGGAAGCTCATCAAGAATATCTTGCAAGGCAACGAAACTCCTCAAGACCTGACCACGGCTTATTCTTCGGTTCCGGACCAG
AACTCAGCCGAGTGCAAGGCCGACAAGTGTTGCATATGGAAGCACATCGCGGATGAGATGAAGTCCAAGATGACGGGGGACGCCGGACGTTGCAACAACCTTGCGAGACAATGCATTCGC
ATGGGGTTTCATGACGCAGCAACCTGGTCTTTGGACACGGGCAAAGACGGCGGCGCGGACGGGTCATTGGTTCTAGCTAGAGAATGTTTTGACCGCCAGGTAAACAATGGAGTGACAGAC
GGCTGTAATCAGATGCAGGCTTGGTTTGACACGTACAAGTCGTTTGGTGTCAGCATGGCAGATCTGATCCAGATGGGCG
GTACGTTTTGCACAGCGCACCCATATTGCCTCCCACCAGAG
AGTTTCCAGGTGGACAAAAGATGATGGGAGTTGTTGCTAACACGTCAACTGGTCCTCCAGCAAACGTTGCCACGGTTGTCTGCCCCCTCGGACCCCGTGTCCGCAGCTTTGTTGGGCGCA
AAGACAACTCCAACCCATCACCAGACGGCCTTTTGCCATCGGCGTTTGACTCGGCCGATCAACTGATTTCTCTCTTCGCCAACAAGACAATCAGTGCCAGCCAGCTCGTGGCCCTGGTCG
GCGCCCACACCACCAGCCAGCAGTTCTTTGTTGATGCCAACCGCGCCGGAGACCCTCAGGACAGCACCCCCGGCGTATGGGACACCAACTTTTACGGAGAGACCACCGACGCCAGTTCGC
CCAAGCAAGTATTCAAGTTTCAAAGCGATATCAACCTGTCTCAAGATTCTAGGGCCACGGGTGCTTGGACGGCGTTTACCGGGACACATGGACAGCGTCCTTGGAATGGG
GTAAGTGACA
CCACAAAAATATATATATACATATATATGAGCTTTATCTCTTCGGCCTCCCAAAGTGCTCGCAGTAGAATCAGTCCATGTTTCTTATATATTTTTTATATTCTGACGTTTTTATTCTAGG
CCTATGCTGCGGCGTACGTTCGAATGAGCATGTTGGGCGTGTATAATACCAATGACTTGACCGAGTGCACAAAGGCGCTCCCGCTGCCCATCACTTCATTCTCATCTCCCGATGCCGCGG
CCTTGGCTGACTTTGCAAACGGCGGCGCGCCTGATGCCGCCAAGAACGCTTCCAATGGAGATGTTATTGTAGTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGCCGCTCTTGTAATACTCTCGGCCATCTCCATGGCGAATGCCTTTCCGGGCATGTCCGACCTCCGGCATGTACGCCGTGCGCAAGACGAGGAGAATACCAAGAAACTACCTGGG
GACTTGGAGGGTCAAGACGAAAGCACCATGTCTGAGACTGGGAAGCTCATCAAGAATATCTTGCAAGGCAACGAAACTCCTCAAGACCTGACCACGGCTTATTCTTCGGTTCCGGACCAG
AACTCAGCCGAGTGCAAGGCCGACAAGTGTTGCATATGGAAGCACATCGCGGATGAGATGAAGTCCAAGATGACGGGGGACGCCGGACGTTGCAACAACCTTGCGAGACAATGCATTCGC
ATGGGGTTTCATGACGCAGCAACCTGGTCTTTGGACACGGGCAAAGACGGCGGCGCGGACGGGTCATTGGTTCTAGCTAGAGAATGTTTTGACCGCCAGGTAAACAATGGAGTGACAGAC
GGCTGTAATCAGATGCAGGCTTGGTTTGACACGTACAAGTCGTTTGGTGTCAGCATGGCAGATCTGATCCAGATGGGCG
CAAACGTTGCCACGGTTGTCTGCCCCCTCGGACCCCGTGTC
CGCAGCTTTGTTGGGCGCAAAGACAACTCCAACCCATCACCAGACGGCCTTTTGCCATCGGCGTTTGACTCGGCCGATCAACTGATTTCTCTCTTCGCCAACAAGACAATCAGTGCCAGC
CAGCTCGTGGCCCTGGTCGGCGCCCACACCACCAGCCAGCAGTTCTTTGTTGATGCCAACCGCGCCGGAGACCCTCAGGACAGCACCCCCGGCGTATGGGACACCAACTTTTACGGAGAG
ACCACCGACGCCAGTTCGCCCAAGCAAGTATTCAAGTTTCAAAGCGATATCAACCTGTCTCAAGATTCTAGGGCCACGGGTGCTTGGACGGCGTTTACCGGGACACATGGACAGCGTCCT
TGGAATGGG
GCCTATGCTGCGGCGTACGTTCGAATGAGCATGTTGGGCGTGTATAATACCAATGACTTGACCGAGTGCACAAAGGCGCTCCCGCTGCCCATCACTTCATTCTCATCTCCC
GATGCCGCGGCCTTGGCTGACTTTGCAAACGGCGGCGCGCCTGATGCCGCCAAGAACGCTTCCAATGGAGATGTTATTGTAGTGTAG

Retrieve as FASTA