Entry information : PbreMnP04 (MnP4-long)
Entry ID 9640
Creation 2011-11-01 (Christophe Dunand)
Last sequence changes 2011-11-03 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Catherine Mathe (Scipio))
Peroxidase information: PbreMnP04 (MnP4-long)
Name (synonym) PbreMnP04 (MnP4-long)
Class Manganese peroxidase    [Orthogroup: MnP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phlebia
Organism Phlebia brevispora    [TaxId: 194682 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PbreMnP04
start..stop
S start..stop
PbreMnP03 704 0 1..383 1..383
PbreMnP01 704 0 1..381 1..381
PbreMnP07 691 0 1..383 1..383
PbreMnP05 649 0 1..381 1..381
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 33..158 126 N° 2 219..270 52 N° 3 330..356 27 N° 4 424..463 40
N° 5 521..698 178 N° 6 764..985 222 N° 7 1046..1093 48 N° 8 1150..1303 154
N° 9 1372..1507 136 N° 10 1571..1647 77 N° 11 1706..1797 92  
join(33..158,219..270,330..356,424..463,521..698,764..985,1046..1093,1150..1303, 1372..1507,1571..1647,1706..1797)


exon

Literature and cross-references PbreMnP04 (MnP4-long)
DNA ref. JGI genome:   scaffold_1398 (33..1797)
Protein sequence: PbreMnP04 (MnP4-long)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   383 (365)
PWM (Da):   %s   40337.99 (38501.0)  
PI (pH):   %s   4.31 (4.31) Peptide Signal:   %s   cut: 19 range:19-383
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFTSLLALVALVAYTTASPARTVACADGTRVTNEACCAFIPLAQDLQNTIFQNDCGEDTHEVIRLTFHDAVAISRSQGPKAGGGADGSMLLFPLVEPEFSANNGIDDSVNNLIPFMARHPTISAGDIVQFAGAVALSNCGAPQLEFLAGRPNKTIAAIEGLIPEPQDSVTKILERFEDAGGFTPFEVVSLLASHSVARADKVDETIDAAPFDSTPFTFDSQVFLEVLLKGTGFPGTGNNTGEVASPLPLGSGSDTGEIRLQSDFALARDERTACFWQSFVNEQEFMAQSFKAAMAKLAVLGHNRDDLIDCSDVVPVPKPAVKKPTTFPATKNSKDLELTCTALRFPTLTTPGATETLIPHCSDGAMNCTTVQFTGPATAS

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCACTTCGCTACTCGCACTCGTCGCTCTAGTGGCGTACACCACTGCCTCGCCTGCCCGCACCGTTGCCTGCGCTGACGGCACTCGCGTTACCAACGAGGCATGCTGTGCCTTC
ATTCCT
GTATGCAACTCTGCCAACATCAGCTCTGTTCAACTTTCTGACCGGCCCACCCTCTTTCAGCTTGCCCAGGATCTCCAGAACACCATATTCCAGAATGATTGTGGTGAAGATAGT
GAGTTTTCATTCGACGCATATAAGTGGCGATGGCGGTGCTGATGAGTGTTTTTGTAGCACACGAGGTCATTCGGTTGACGTTCCGTAAGTTTCTAGTATTTCGAGATCGCAATGTTTTGG
AGGAATGCTGATGCTATTGTAACACCACCAGATGACGCCGTCGCTATCAGTCGAAGCCAAGGTCCTAAAGCGTAAGTTTTTATATAAACCTGATCAACATATTTTGACTGAAGGATTTGC
TCGGATAGCGGTGGAGGCGCCGACGGCTCTATGCTCCTGTTCCCCCTCGTCGAGCCTGAGTTCTCCGCTAACAACGGTATCGACGACAGCGTCAACAACTTGATCCCTTTCATGGCCAGG
CACCCAACGATCAGTGCTGGTGACATCGTCCAGTTCGCCGGTGCGGTTGCGCTCAGCAACTGCCCG
GTAAGCCCGTTTCCTGTCCTTGACGTTTTCAAGTTTGTTCCGCTGACGTGCTAC
TATCGCTTCAGGGCGCACCGCAACTTGAGTTCCTCGCTGGCCGCCCGAACAAGACGATTGCAGCGATCGAAGGCTTGATCCCCGAGCCCCAGGACAGCGTGACGAAGATTCTCGAGCGCT
TTGAGGATGCAGGTGGCTTCACGCCGTTCGAGGTTGTCTCGCTACTGGCTTCGCACAGTGTCGCGCGTGCAGACAAGGTCGATGAGACGATCGACGCTGCACCCTTCGATTCG
GTTAGTC
GATTGTACCACATTTTGGGAACCAGAGACTGATGACATATGTGGAATTTTAAGACTCCCTTCACGTTCGACAGCCAGGTCTTCCTTGAGGTCCTGCTCAAGGTGAGCAACCATCGCATAT
GGCATCGAGAAGTACGCACAGATTCAAATGCGCACAGGGCACCGGATTCCCTGGGACGGGCAATAACACTGGAGAAGTTGCGTCTCCTCTACCTCTCGGCTCCGGCTCCGACACTGGCGA
AATACGTCTTCAGTCCGACTTTGCTCTCGCTCGCGATGAGCGCACGGCCTGCTTCTGGCAAAGTTTCGTCA
GTGCGTGCTAATGGTTCTCGTCTTTATTCATATGACGTTACTTACTTTA
CCCCTTGCCATCTGCGCAGACGAGCAAGAGTTCATGGCACAGAGCTTCAAGGCCGCCATGGCGAAGCTGGCTGTCCTCGGCCACAACAGGGATGATCTGATCGATTGCTCTGATGTTGTC
CCTGTGCCTAAGCCCGCAGTTAAGAAGCCTACGAC
GTGAGTGTGGACCTTGTGTCTGGCATAGAATACTTTGCTGACTCAAACGTACCATGGATATAGCTTCCCGGCCACCAAGAATTCC
AAGGATCTCGAGCTCACCTGCACCGCTTTGAGGTTCCCCACGCTCACCACTGACC
GTAAGTTTACATATGGCTGCTTCAAATACCCTCAAGACTAATAGCGAACTTTTCGTAGCTGGTGC
TACTGAGACCCTCATTCCTCACTGCTCTGACGGTGCCATGAACTGCACTACCGTGCAGTTCACCGGCCCCGCCACCGCCAGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCACTTCGCTACTCGCACTCGTCGCTCTAGTGGCGTACACCACTGCCTCGCCTGCCCGCACCGTTGCCTGCGCTGACGGCACTCGCGTTACCAACGAGGCATGCTGTGCCTTC
ATTCCT
CTTGCCCAGGATCTCCAGAACACCATATTCCAGAATGATTGTGGTGAAGATACACACGAGGTCATTCGGTTGACGTTCCATGACGCCGTCGCTATCAGTCGAAGCCAAGGTCCT
AAAGC
CGGTGGAGGCGCCGACGGCTCTATGCTCCTGTTCCCCCTCGTCGAGCCTGAGTTCTCCGCTAACAACGGTATCGACGACAGCGTCAACAACTTGATCCCTTTCATGGCCAGGCAC
CCAACGATCAGTGCTGGTGACATCGTCCAGTTCGCCGGTGCGGTTGCGCTCAGCAACTGCCCG
GGCGCACCGCAACTTGAGTTCCTCGCTGGCCGCCCGAACAAGACGATTGCAGCGATC
GAAGGCTTGATCCCCGAGCCCCAGGACAGCGTGACGAAGATTCTCGAGCGCTTTGAGGATGCAGGTGGCTTCACGCCGTTCGAGGTTGTCTCGCTACTGGCTTCGCACAGTGTCGCGCGT
GCAGACAAGGTCGATGAGACGATCGACGCTGCACCCTTCGATTCG
ACTCCCTTCACGTTCGACAGCCAGGTCTTCCTTGAGGTCCTGCTCAAGGGCACCGGATTCCCTGGGACGGGCAAT
AACACTGGAGAAGTTGCGTCTCCTCTACCTCTCGGCTCCGGCTCCGACACTGGCGAAATACGTCTTCAGTCCGACTTTGCTCTCGCTCGCGATGAGCGCACGGCCTGCTTCTGGCAAAGT
TTCGTCA
ACGAGCAAGAGTTCATGGCACAGAGCTTCAAGGCCGCCATGGCGAAGCTGGCTGTCCTCGGCCACAACAGGGATGATCTGATCGATTGCTCTGATGTTGTCCCTGTGCCTAAG
CCCGCAGTTAAGAAGCCTACGAC
CTTCCCGGCCACCAAGAATTCCAAGGATCTCGAGCTCACCTGCACCGCTTTGAGGTTCCCCACGCTCACCACTGACCCTGGTGCTACTGAGACCCTC
ATTCCTCACTGCTCTGACGGTGCCATGAACTGCACTACCGTGCAGTTCACCGGCCCCGCCACCGCCAGCTAG

Retrieve as FASTA